ID: 931229949

View in Genome Browser
Species Human (GRCh38)
Location 2:60365702-60365724
Sequence GAGCTTCCACCCATGAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229942_931229949 26 Left 931229942 2:60365653-60365675 CCGGCTCGTTCTATTTGTGCAAG No data
Right 931229949 2:60365702-60365724 GAGCTTCCACCCATGAAATGTGG No data
931229946_931229949 2 Left 931229946 2:60365677-60365699 CCTAGTCTTAGAGGCCACAGGGC No data
Right 931229949 2:60365702-60365724 GAGCTTCCACCCATGAAATGTGG No data
931229941_931229949 27 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229949 2:60365702-60365724 GAGCTTCCACCCATGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229949 Original CRISPR GAGCTTCCACCCATGAAATG TGG Intergenic
No off target data available for this crispr