ID: 931229951

View in Genome Browser
Species Human (GRCh38)
Location 2:60365704-60365726
Sequence GCTTCCACCCATGAAATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229947_931229951 -10 Left 931229947 2:60365691-60365713 CCACAGGGCCTGAGCTTCCACCC No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data
931229942_931229951 28 Left 931229942 2:60365653-60365675 CCGGCTCGTTCTATTTGTGCAAG No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data
931229946_931229951 4 Left 931229946 2:60365677-60365699 CCTAGTCTTAGAGGCCACAGGGC No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data
931229941_931229951 29 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229951 Original CRISPR GCTTCCACCCATGAAATGTG GGG Intergenic
No off target data available for this crispr