ID: 931231069

View in Genome Browser
Species Human (GRCh38)
Location 2:60375365-60375387
Sequence CCCCTGACCCCTGTGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931231062_931231069 2 Left 931231062 2:60375340-60375362 CCAATAAGCGAGTAGCCGAAGCT No data
Right 931231069 2:60375365-60375387 CCCCTGACCCCTGTGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931231069 Original CRISPR CCCCTGACCCCTGTGGTTGG GGG Intergenic
No off target data available for this crispr