ID: 931231726

View in Genome Browser
Species Human (GRCh38)
Location 2:60380821-60380843
Sequence ACAGCCCCACAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931231726_931231729 -5 Left 931231726 2:60380821-60380843 CCCAGCTCCATCTGTGGGGCTGT No data
Right 931231729 2:60380839-60380861 GCTGTCTTTCTGCAAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931231726 Original CRISPR ACAGCCCCACAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr