ID: 931232334

View in Genome Browser
Species Human (GRCh38)
Location 2:60385449-60385471
Sequence AGAGCAGCCTCCTCTTTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931232332_931232334 -6 Left 931232332 2:60385432-60385454 CCAAACTGTCTACAAGAAGAGCA No data
Right 931232334 2:60385449-60385471 AGAGCAGCCTCCTCTTTCGTGGG No data
931232331_931232334 6 Left 931232331 2:60385420-60385442 CCTAGACATTTACCAAACTGTCT No data
Right 931232334 2:60385449-60385471 AGAGCAGCCTCCTCTTTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931232334 Original CRISPR AGAGCAGCCTCCTCTTTCGT GGG Intergenic
No off target data available for this crispr