ID: 931239822

View in Genome Browser
Species Human (GRCh38)
Location 2:60442206-60442228
Sequence AGTGAGGTATAGACCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931239822_931239828 13 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239828 2:60442242-60442264 TTACTATATTTCAGTGGGAGGGG No data
931239822_931239831 23 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239831 2:60442252-60442274 TCAGTGGGAGGGGAAATATGGGG No data
931239822_931239824 7 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239824 2:60442236-60442258 TACACTTTACTATATTTCAGTGG No data
931239822_931239826 11 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239826 2:60442240-60442262 CTTTACTATATTTCAGTGGGAGG No data
931239822_931239830 22 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239822_931239829 21 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239829 2:60442250-60442272 TTTCAGTGGGAGGGGAAATATGG No data
931239822_931239827 12 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239822_931239825 8 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239825 2:60442237-60442259 ACACTTTACTATATTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931239822 Original CRISPR AGTGAGGTATAGACCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr