ID: 931239827

View in Genome Browser
Species Human (GRCh38)
Location 2:60442241-60442263
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931239817_931239827 23 Left 931239817 2:60442195-60442217 CCTCCCTGTCCCCACTCAAGGTC No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239823_931239827 -4 Left 931239823 2:60442222-60442244 CCTCACTTTTTCATTACACTTTA No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239821_931239827 13 Left 931239821 2:60442205-60442227 CCCACTCAAGGTCTATACCTCAC No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239822_931239827 12 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239818_931239827 20 Left 931239818 2:60442198-60442220 CCCTGTCCCCACTCAAGGTCTAT No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239819_931239827 19 Left 931239819 2:60442199-60442221 CCTGTCCCCACTCAAGGTCTATA No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data
931239820_931239827 14 Left 931239820 2:60442204-60442226 CCCCACTCAAGGTCTATACCTCA No data
Right 931239827 2:60442241-60442263 TTTACTATATTTCAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr