ID: 931239830

View in Genome Browser
Species Human (GRCh38)
Location 2:60442251-60442273
Sequence TTCAGTGGGAGGGGAAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931239822_931239830 22 Left 931239822 2:60442206-60442228 CCACTCAAGGTCTATACCTCACT No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239818_931239830 30 Left 931239818 2:60442198-60442220 CCCTGTCCCCACTCAAGGTCTAT No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239819_931239830 29 Left 931239819 2:60442199-60442221 CCTGTCCCCACTCAAGGTCTATA No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239820_931239830 24 Left 931239820 2:60442204-60442226 CCCCACTCAAGGTCTATACCTCA No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239821_931239830 23 Left 931239821 2:60442205-60442227 CCCACTCAAGGTCTATACCTCAC No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data
931239823_931239830 6 Left 931239823 2:60442222-60442244 CCTCACTTTTTCATTACACTTTA No data
Right 931239830 2:60442251-60442273 TTCAGTGGGAGGGGAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931239830 Original CRISPR TTCAGTGGGAGGGGAAATAT GGG Intergenic
No off target data available for this crispr