ID: 931240871

View in Genome Browser
Species Human (GRCh38)
Location 2:60451392-60451414
Sequence GTTTGGTATTTTTTACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931240871_931240873 5 Left 931240871 2:60451392-60451414 CCAAGCAGTAAAAAATACCAAAC 0: 1
1: 0
2: 0
3: 25
4: 311
Right 931240873 2:60451420-60451442 AAAGTTCTGTGCAAATTAACTGG 0: 1
1: 0
2: 0
3: 30
4: 243
931240871_931240874 6 Left 931240871 2:60451392-60451414 CCAAGCAGTAAAAAATACCAAAC 0: 1
1: 0
2: 0
3: 25
4: 311
Right 931240874 2:60451421-60451443 AAGTTCTGTGCAAATTAACTGGG 0: 1
1: 0
2: 0
3: 17
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931240871 Original CRISPR GTTTGGTATTTTTTACTGCT TGG (reversed) Intronic
902112128 1:14090425-14090447 GTCTGGTATTTTTTCCAGCTTGG + Intergenic
903761538 1:25702116-25702138 GTTTGGGATTTTATCCTTCTTGG - Intronic
906559966 1:46749095-46749117 GTTACGCATTTTTTGCTGCTGGG - Intergenic
906889969 1:49700437-49700459 TTTTGGTATTTTTTACAGTAAGG - Intronic
907178534 1:52549158-52549180 GTTTTGTATTTTTTTCTCCTTGG - Intronic
907264667 1:53250322-53250344 ATTTGGCTTTTTTTACTGCCAGG + Intronic
907690662 1:56661582-56661604 ATTTGGTAGTTTTTACATCTTGG + Intronic
907746317 1:57217321-57217343 GTCTGGTCTTTTCTATTGCTTGG + Intronic
908635241 1:66156585-66156607 GTTTGTTTTTTTTTTCTGATGGG - Intronic
910042359 1:82868028-82868050 GGTTGGTATTGTTTACATCTTGG + Intergenic
910409159 1:86923042-86923064 TTTAGATAGTTTTTACTGCTAGG + Intronic
912498276 1:110105388-110105410 GTTTGGTATGTTTAAATGCATGG + Intergenic
912837939 1:113013236-113013258 GTTTGATTTTTTTTAATACTTGG - Intergenic
913491140 1:119381052-119381074 GTTTGGTTTTGTTTTCTCCTTGG + Intronic
914906316 1:151748641-151748663 GTTTGGTTTTTTTTAGAGATGGG + Intergenic
915264054 1:154702362-154702384 GCTTGCTATTTTTTAATGATAGG - Exonic
917409113 1:174739922-174739944 GTTTAGTCTTTTGTACTTCTTGG + Intronic
917475304 1:175364328-175364350 TTTTTTTTTTTTTTACTGCTAGG + Intronic
918466652 1:184827600-184827622 GTTTTGTATACTTAACTGCTAGG + Intronic
918792402 1:188846458-188846480 GTTTGGTATTTTTGCCTTCGTGG - Intergenic
919366115 1:196663140-196663162 GCTTGGAATTTTTTAATTCTTGG + Intronic
919722864 1:200858459-200858481 GTTTGCTATTTTTCTCTCCTGGG + Exonic
920063363 1:203245176-203245198 GTTTGGTTTTTTTTTTTTCTTGG - Intronic
920651669 1:207842050-207842072 TGTTGGTTTTTTTTCCTGCTTGG + Intergenic
921805120 1:219445479-219445501 TTTTGGTGTTTTTTATTACTTGG + Intergenic
922678629 1:227570672-227570694 GTTTTTTTTTTTTTACTGCAAGG + Intronic
923141708 1:231165348-231165370 GTTTGGTATTTTTTTCCAATGGG - Intronic
923154157 1:231261789-231261811 GTTTTATATTTTTTTCTTCTAGG + Intronic
923465738 1:234246719-234246741 GTGTGGTTTTTATTAATGCTAGG - Intronic
1063608271 10:7541774-7541796 TTTGGGGATTTTTTACTTCTTGG + Intergenic
1064820981 10:19332615-19332637 GTTTGATATTATTTGCTTCTTGG + Intronic
1065160080 10:22910297-22910319 TTTTGGTATTTTTTTCTTTTTGG + Intergenic
1065481448 10:26198145-26198167 GTTTTGTTTTTTTTTCTCCTTGG + Intronic
1065798551 10:29329932-29329954 GTTTGCTAATTATTACTTCTAGG - Intergenic
1066089922 10:32007084-32007106 GTTTCGTATTTTTTCCTTTTTGG - Intergenic
1068426338 10:56869782-56869804 GTTTTGTCTTTTCTACTGTTTGG - Intergenic
1068457888 10:57282451-57282473 CTTCAGTATTTTTTACTGCAAGG + Intergenic
1069163084 10:65113740-65113762 GTTTGGTTTTGTTTTCGGCTTGG + Intergenic
1071872499 10:89810658-89810680 TTTTTAAATTTTTTACTGCTAGG - Intergenic
1072081077 10:92032665-92032687 TTTTTGTATTTGTTTCTGCTGGG - Intergenic
1072125716 10:92443516-92443538 TTTTTGTATTTTTTAGAGCTGGG - Intergenic
1074901520 10:117820059-117820081 TTTCGGTTTTTTTTTCTGCTTGG - Intergenic
1075310318 10:121408220-121408242 GTTTGGAATTGTTTTCTACTAGG - Intergenic
1079326936 11:19501503-19501525 GTTTAGCATTTCTTCCTGCTTGG - Intronic
1079593311 11:22208341-22208363 GTTTGTTCCTTTTTACTGATGGG - Intronic
1080024710 11:27601224-27601246 GTTTGGTTTGTTTTATTCCTAGG + Intergenic
1080866272 11:36198043-36198065 GTTTGGTATTTTTTAGAGACAGG - Intronic
1081878067 11:46424215-46424237 GTTTGCCCTTTTTTTCTGCTGGG - Intronic
1082167051 11:48962216-48962238 TTTTTGTATTTTTTAGAGCTGGG + Intergenic
1083353145 11:62045456-62045478 GCTTTGTATTTTTTAGTGCCTGG + Intergenic
1083732041 11:64657641-64657663 CTTTGGTATCTTTTACTGTTGGG - Intronic
1085968860 11:81562883-81562905 GTTAGGTATTTTGTAATGCAGGG - Intergenic
1087449580 11:98301562-98301584 TTTTGGTATTTTTTGCTGATAGG + Intergenic
1087841262 11:102923157-102923179 GTTAGGTATTTTTGAGTGCTGGG - Intergenic
1087897617 11:103604481-103604503 CTTTGGTGTTCTTTATTGCTAGG - Intergenic
1088051650 11:105523391-105523413 AATTGGAATTTTTTTCTGCTAGG - Intergenic
1088346876 11:108836457-108836479 GTTTGTTATTTTTAATTGCATGG + Intronic
1090967155 11:131609039-131609061 TTTTGTTATTTTTAACTGTTGGG - Intronic
1091470993 12:727051-727073 GATTGGCTTTTTCTACTGCTTGG - Intergenic
1092490594 12:8941332-8941354 ATCTGGTATTTCTTGCTGCTTGG - Exonic
1092637547 12:10467874-10467896 GGTTGGAATTTTTTCCTTCTGGG + Intergenic
1092649779 12:10621720-10621742 GATAGGTATATTTTACTGCATGG + Intronic
1093454925 12:19355773-19355795 GTTAGGCATTTTTTACAGATTGG + Intronic
1094161168 12:27392552-27392574 ATGTGGTATGTTTTACTGTTAGG + Intronic
1096581336 12:52587444-52587466 CTTTGGGATTTTTTACAACTTGG + Intronic
1096704695 12:53411993-53412015 GTTTTGTTTTTGTTACTGCCTGG + Intronic
1096796839 12:54083003-54083025 ATTTGGGATTTTTTGTTGCTAGG + Intergenic
1096945895 12:55409826-55409848 ATCTGGTATTTCTTGCTGCTTGG + Intergenic
1099014948 12:77333190-77333212 GTTTTATATTTTTAACTCCTGGG + Intergenic
1100649333 12:96567571-96567593 GTTTGCTATTGTCTAGTGCTTGG + Intronic
1101068934 12:101052499-101052521 GTTTTTCATTTTTTACTTCTAGG + Intronic
1101280499 12:103250125-103250147 GTATAGTATGTTTTACTTCTTGG + Intronic
1102668262 12:114595339-114595361 GTTTGTTACTTTATATTGCTGGG - Intergenic
1103080338 12:118018787-118018809 TTTTGGTATTTTTTATTGAATGG + Intronic
1103811869 12:123621228-123621250 TCTTGGTAGTTTTTACTGTTTGG + Exonic
1104208386 12:126662441-126662463 GTTTGGTTTTTTTTTCTGTTTGG - Intergenic
1105048343 12:133025930-133025952 GTTTGGGCTTTCTTACTGCAGGG - Exonic
1106000236 13:25715713-25715735 GTTAGGTTGTTTTTACTTCTTGG + Intronic
1106061966 13:26302093-26302115 GTTTTGTGTTTTTTAGAGCTGGG - Intronic
1110297169 13:73880799-73880821 GTTTGGTTAGTTATACTGCTAGG - Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112056808 13:95696502-95696524 ATTTGGTATTTTTAACTTTTGGG + Intronic
1115325670 14:32135173-32135195 GTTTGGTATTTTTTCTTTCTAGG - Intronic
1115770435 14:36660711-36660733 ATTTGGGAGTTTGTACTGCTTGG - Intronic
1115825047 14:37261782-37261804 ATTTTGTACTCTTTACTGCTAGG + Intronic
1117499104 14:56334347-56334369 GTTTGAAATTTTTTAATGGTTGG + Intergenic
1120037691 14:79716567-79716589 CTTTGGTCTTTCTTTCTGCTTGG + Intronic
1120106285 14:80498995-80499017 TTCAGGTATTTTTTACTGATCGG - Intronic
1121026105 14:90617249-90617271 GTTTGGGGTTCTTTACTGCAGGG - Intronic
1124991510 15:34678634-34678656 ATTTGCTCTTTTGTACTGCTCGG + Intergenic
1125374041 15:39010083-39010105 GCTTGGTATCTTTCATTGCTTGG + Intergenic
1126977543 15:54200791-54200813 GTTATGTATTTTCTTCTGCTGGG - Intronic
1127175274 15:56347909-56347931 GATTGATTTTTTTTACTGTTGGG - Intronic
1127406144 15:58648584-58648606 TTATGTTATTTTTTTCTGCTTGG - Intronic
1127729114 15:61781901-61781923 GTTTGTTCCTTTATACTGCTGGG + Intergenic
1128889541 15:71318387-71318409 GTTTGGTGTTTTCTACACCTGGG + Intronic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1130566299 15:84999091-84999113 GTTTGGTAAATTTTCCTGATAGG + Intronic
1130871494 15:87975668-87975690 GTTTTCCATGTTTTACTGCTAGG - Intronic
1131516348 15:93080060-93080082 TTTTGGTAGTTTTTTCTTCTTGG - Intronic
1131640428 15:94286707-94286729 GTTTGTTTTCTTTTTCTGCTTGG + Intronic
1131788361 15:95937242-95937264 TTTTTTTATTTTTTACAGCTAGG - Intergenic
1134773307 16:16829719-16829741 GTTTGGTACTGTTAACTGCCAGG + Intergenic
1136090757 16:27918275-27918297 GGTTGTTGTTTTTTTCTGCTGGG - Intronic
1137684772 16:50379068-50379090 GTTTTGTTTTGTTTAATGCTTGG - Intergenic
1137838814 16:51621242-51621264 TCTTGGTATATTTTACTTCTTGG + Intergenic
1137876468 16:52001024-52001046 GTTTTATATTTTTTAATGATGGG + Intergenic
1139666474 16:68460237-68460259 GTTTGGTTTTTGTGACTGATTGG + Intergenic
1141263731 16:82476653-82476675 CTTTTGTCTTTTTCACTGCTTGG + Intergenic
1142900991 17:3011447-3011469 TTTTGGTATTTTTTTTTCCTGGG + Intronic
1143066291 17:4250883-4250905 CTTTGGTCTTTTAAACTGCTGGG + Intronic
1146632105 17:34477734-34477756 GGTTCATATTTTTTAGTGCTAGG - Intergenic
1146636213 17:34507416-34507438 GTCTGGGATTTGTTCCTGCTGGG - Intergenic
1147285254 17:39397735-39397757 ATTTTGTATTTGCTACTGCTGGG - Intronic
1148247621 17:46045081-46045103 GTGTGGTAGATTTTACTACTGGG - Intronic
1151098205 17:71523552-71523574 GTTTTGTCTTTTTAAGTGCTTGG - Intergenic
1151194878 17:72424340-72424362 TTTTTTTTTTTTTTACTGCTGGG + Intergenic
1154151707 18:11911223-11911245 GTTTAAGATTTTTTTCTGCTGGG + Intergenic
1154396609 18:13996684-13996706 GTTTGTTTGTTTTTATTGCTTGG - Intergenic
1154404567 18:14077382-14077404 GTTTGATTTTTTTTGCTGCAGGG + Intronic
1156076922 18:33289613-33289635 GTTTGTTTTTTTTTATTTCTTGG - Intronic
1157054801 18:44214177-44214199 GTTGGGTATTTTTTACTTTATGG + Intergenic
1158791222 18:60782857-60782879 ATTTTGTATTATTTACTTCTGGG - Intergenic
1159304552 18:66623735-66623757 TTTTTTTTTTTTTTACTGCTAGG + Intergenic
1159454470 18:68643165-68643187 TTGTGGTATTATTTGCTGCTAGG + Intergenic
1159829078 18:73250594-73250616 GTGAGGTATTTTTTTCTCCTTGG - Intronic
1160746811 19:715602-715624 CTTTGGTGTTTGTTCCTGCTAGG + Intronic
1162237347 19:9319695-9319717 GTTTGGTTTTTTTTTCTGCAGGG - Intergenic
1162896162 19:13765727-13765749 TTTTTGTCTTGTTTACTGCTGGG + Intronic
1163369653 19:16894733-16894755 GTTTGTTCTTTTGTATTGCTGGG - Intronic
1165165445 19:33850718-33850740 GCTTGGTTCTTTTTTCTGCTTGG - Intergenic
1165184818 19:34008757-34008779 GTTTGTTTCTTTTTATTGCTGGG - Intergenic
1166948112 19:46409442-46409464 ATTTGCTGTTTTTCACTGCTAGG + Intergenic
1168338358 19:55609705-55609727 GTTTGATATTTGTTATTGCCTGG - Intronic
927439559 2:23103330-23103352 ATTTGATATTTTATAGTGCTAGG - Intergenic
927620969 2:24658204-24658226 GTTTGGGATTTTATATTGATAGG - Intronic
929623523 2:43381992-43382014 GTTTGTTCTTTTTTAATGGTTGG - Intronic
931240871 2:60451392-60451414 GTTTGGTATTTTTTACTGCTTGG - Intronic
931278972 2:60771270-60771292 CTTTGATTTTTTTTTCTGCTTGG + Intronic
931701834 2:64915419-64915441 GTTTGATATTTTAAGCTGCTGGG + Intergenic
933140118 2:78781999-78782021 ATTTTGTATTTGTTATTGCTAGG + Intergenic
933852667 2:86383342-86383364 GTTTGTTTCTTTTTACAGCTAGG + Intergenic
935500037 2:103827843-103827865 GTAGGCTATTTTTTACTGGTAGG + Intergenic
935985428 2:108667945-108667967 TATTGGTATTTTTTATTGTTTGG + Intronic
936044075 2:109172654-109172676 GTTTGGGATCTGATACTGCTGGG + Intronic
937978723 2:127597942-127597964 TTTTGTTACTTTTTATTGCTCGG + Intronic
939015651 2:136900624-136900646 ATTTGGTATTTTTTATTTCCAGG + Intronic
939293491 2:140224894-140224916 ATTTGGTATTTTTAACTTTTAGG - Intergenic
939946004 2:148411613-148411635 GTTAAGCATTTTTTAATGCTTGG + Intronic
941294997 2:163726768-163726790 TTTTGATAAATTTTACTGCTAGG - Intronic
942982452 2:182098991-182099013 GTTTACTATTTTTTATTGCAAGG + Intronic
943565168 2:189508438-189508460 GTTTGTTTCTTTTTATTGCTGGG - Intergenic
944496433 2:200311760-200311782 GTCTGTTATTTTTTCCTGCTAGG - Intronic
945551892 2:211230631-211230653 GTTTGTTTTTTTTTCCTCCTGGG + Intergenic
948189201 2:236045220-236045242 TTTTTTTATTTTTTCCTGCTTGG + Intronic
1169563179 20:6824160-6824182 GTTTCTTATTTTTTAAAGCTGGG + Intergenic
1169897432 20:10518948-10518970 GTTTGATATTCTTTCCTGCCTGG + Intronic
1170177295 20:13486350-13486372 ACTTGGTATTTTTTACTTCTAGG - Intronic
1170486656 20:16823951-16823973 GTTATTTATTTTTTTCTGCTAGG - Intergenic
1170879372 20:20281829-20281851 GATTGGTATTTTTTCTTTCTTGG + Intronic
1172830174 20:37827176-37827198 ATTTGTTCCTTTTTACTGCTGGG + Intronic
1172853406 20:37982892-37982914 GTTTTCTGTTTTGTACTGCTTGG + Intergenic
1173481721 20:43406111-43406133 TCTTTGTATTTTTTCCTGCTTGG - Intergenic
1173663327 20:44749147-44749169 GATTTGTATTTTTTACTTTTTGG + Intronic
1175859110 20:62140444-62140466 GTGTGGTCCTTTTTACTGCTGGG + Intronic
1177645960 21:23899938-23899960 GTTTGTTTTTTTCTACTGCATGG + Intergenic
1178462206 21:32812696-32812718 TTTTGGTATTTTTTAAGGGTGGG + Intronic
1179466064 21:41574039-41574061 GTTTGTTCCTTTTTATTGCTGGG + Intergenic
1180862332 22:19091902-19091924 CTTTATTATTTCTTACTGCTGGG - Intronic
1182972001 22:34587943-34587965 GTTTTGTTTTGTTTTCTGCTGGG + Intergenic
949660850 3:6276604-6276626 ATTTAGTATTTATTCCTGCTTGG + Intergenic
951560667 3:23963309-23963331 GCTTGGTATTTTCTACTGACAGG + Intronic
951625065 3:24651342-24651364 GTTTGGTAACTTTTTCTGCATGG + Intergenic
952635880 3:35530187-35530209 GTCTGACATTTTTTTCTGCTTGG - Intergenic
953714986 3:45309736-45309758 TTTTTTTTTTTTTTACTGCTAGG + Intergenic
955495701 3:59530053-59530075 ATTAGGTATTTTTTACTTCCTGG + Intergenic
955538290 3:59947977-59947999 GTTTGTTCCTTTTTATTGCTGGG + Intronic
955752676 3:62198396-62198418 ATTTGGTAATTTTTACTCTTTGG - Intronic
956457620 3:69438873-69438895 GTTTGTTAGTTTTGACTGATGGG - Intronic
957622925 3:82619330-82619352 GCTTTTTATTTTTTACTGCAAGG - Intergenic
957845901 3:85735021-85735043 GTTCTTTATTTTTTACTGCATGG + Intronic
957971953 3:87393382-87393404 GTTGGTTATTTTCTTCTGCTAGG - Intergenic
958541075 3:95473784-95473806 GTTTTATATTTGTTTCTGCTAGG - Intergenic
958662906 3:97094301-97094323 GTTTGGAAATATTTATTGCTAGG - Intronic
958681661 3:97339721-97339743 GTGTCGTTTATTTTACTGCTTGG - Intronic
959023356 3:101213637-101213659 GTTTTTTCTTTTTTACTGCATGG - Intergenic
960123748 3:113974930-113974952 ATTAGGTATTTTTTTATGCTTGG + Intronic
962057764 3:131890757-131890779 GTTTCTTATTTTTCAATGCTAGG - Intronic
962138102 3:132758957-132758979 GTTTTGTATTTTGTACTGTTTGG + Intergenic
962497285 3:135953810-135953832 GTTTGGTACATTGTACTGCAGGG + Intergenic
962832957 3:139160164-139160186 ATTTGGTATTATGTGCTGCTTGG - Intronic
962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG + Intronic
962903712 3:139782448-139782470 GTTTGGTGTTTTTTATTTTTTGG - Intergenic
963212727 3:142711215-142711237 GTTTTGTATTTTTTACAGAATGG + Intronic
963499685 3:146109797-146109819 GTTAGATATTTTTCACTACTGGG + Intronic
965164195 3:165173914-165173936 GTTTTGCATTTTTTTCTGTTTGG - Intergenic
965251102 3:166345020-166345042 TTTTGTTATTTTTTTCTGCTTGG - Intergenic
965473851 3:169129992-169130014 GATTTGTATTTTATACTTCTAGG - Intronic
965896862 3:173588144-173588166 ATTTGATATTTTTCAATGCTTGG - Intronic
965952554 3:174328299-174328321 GTTTCCTATTTTTTATTCCTTGG + Intergenic
966488821 3:180503448-180503470 GTTAGGTATGTTTGACTTCTTGG + Intergenic
967066886 3:185926010-185926032 TTTTTGTTTTTTTAACTGCTGGG - Intronic
967079296 3:186034235-186034257 GTTTGATATTTTCTAATGATTGG - Intergenic
968436931 4:597841-597863 TTTTTGTATTTTTTTCTGATGGG + Intergenic
969094801 4:4724205-4724227 GTTTCATATTTTTTAATGGTAGG + Intergenic
970136674 4:12932726-12932748 CTTTAGTAATTTTAACTGCTAGG + Intergenic
970515785 4:16828888-16828910 CTTTGGTATTCTTTGCTGCAGGG - Intronic
971078757 4:23182457-23182479 GTTTATTATTTTTTATTGCTGGG + Intergenic
972539439 4:40026439-40026461 GGTTGTTCTTTTTTAATGCTGGG + Intergenic
973273973 4:48289560-48289582 GTTTGTTACTTTTTATTGCTGGG - Intergenic
973331355 4:48913048-48913070 TTTTGGTATTTTGTACAGATAGG - Intergenic
973671659 4:53225328-53225350 GTTTGGGGTTTTTTATTACTAGG + Intronic
974602279 4:64099090-64099112 TTTTTGTATTTTTTACTACACGG - Intergenic
975361786 4:73478648-73478670 GTTTGATATCTTTTACATCTAGG - Intergenic
975434158 4:74331678-74331700 GCATGGTATTTTTTTCTCCTGGG - Intergenic
975701534 4:77071762-77071784 TTTTGGTATTTTGTATTTCTGGG - Intronic
976144485 4:82028507-82028529 TTTTGATATTTTTTACAGCTTGG - Intronic
976419486 4:84824072-84824094 GTTTGTTCCTTTTTAATGCTGGG - Intronic
977280764 4:95037174-95037196 GTTGGGCATTTTCTAATGCTGGG - Intronic
977643740 4:99387582-99387604 GTTTGTGTTTTTTTACTGGTTGG - Intergenic
978362248 4:107943649-107943671 GTCTGGTATGTTTGACTGCATGG + Intronic
980581980 4:134766900-134766922 GTGTGATAATTTTTACTCCTTGG - Intergenic
981585595 4:146298897-146298919 GTTTGGTCTTCCTCACTGCTTGG - Intronic
981730990 4:147898509-147898531 GTTTGATATTTCTTACTGCCCGG + Intronic
982092272 4:151890907-151890929 ATTTGGTATTATTTTATGCTAGG - Intergenic
983072498 4:163285569-163285591 GTTTTTTCTTTTTTTCTGCTGGG + Intergenic
983786214 4:171732865-171732887 GTTTTGTATCTTTTACTTCTGGG + Intergenic
983965853 4:173808972-173808994 GTTTCAAATTTTTTATTGCTAGG - Intergenic
984580597 4:181505350-181505372 AATTGGTATTATTTACTGTTGGG - Intergenic
985470456 5:39848-39870 ATTTGCTATTTTTTACGACTGGG + Intergenic
986895590 5:12362597-12362619 GTTTTGTATCTTTTGCTGCCAGG + Intergenic
987724739 5:21683590-21683612 GTATTGTATTTTTTCCTACTAGG + Intergenic
988352181 5:30123486-30123508 GTTTGTTTATTTTTATTGCTAGG + Intergenic
990221639 5:53597198-53597220 GCTTGGTCTTTTTTACAACTTGG + Intronic
990612055 5:57467581-57467603 GCATGGTAGTTTTTACGGCTAGG + Intergenic
991340992 5:65608937-65608959 GTTTTTTTTTTTTTTCTGCTTGG - Intronic
991636837 5:68714885-68714907 TATTGTTAATTTTTACTGCTAGG - Intergenic
993423885 5:87738060-87738082 GATTGACTTTTTTTACTGCTTGG + Intergenic
994611037 5:102039888-102039910 TTTTGGTATTTTTAACTCATTGG + Intergenic
996267520 5:121559596-121559618 ACTTGGTATTGTTTATTGCTAGG - Intergenic
997096032 5:130912308-130912330 CTTAGGAAATTTTTACTGCTAGG - Intergenic
997617147 5:135255223-135255245 GTCTGGTTTGTTTTACTGTTAGG - Intronic
1000429176 5:161130321-161130343 GTTGGGTAGTTTTTGCTGCAAGG + Intergenic
1001653749 5:173332509-173332531 GTTTGTTATTTTTTTCTGTCCGG - Intergenic
1002155711 5:177277253-177277275 TTTTTGTATTTTTTAGTGATTGG + Intronic
1003469184 6:6412725-6412747 TTTTGGTTTTTTTTAATGCAAGG + Intergenic
1004476426 6:15977401-15977423 GTTTGTTCTTTTTTACTCATTGG + Intergenic
1004766707 6:18737127-18737149 ATTTGTTATTTTTTACTGTGAGG - Intergenic
1007362018 6:41365142-41365164 ATTTGTTTTTTTTTACTGTTGGG - Intergenic
1007915380 6:45556789-45556811 TTTCGCTATTTTTTACTGCAAGG - Intronic
1007925349 6:45645520-45645542 GTTTGGTTTTTGTTTCTGCAGGG + Intronic
1008049525 6:46885927-46885949 GTTTGTTATTTTATGATGCTAGG + Intronic
1011084192 6:83520928-83520950 ATTTGGTATATCTTAATGCTTGG - Intronic
1011541130 6:88431198-88431220 GTTTGTTCTTTTTTATTGCTGGG - Intergenic
1011904706 6:92350497-92350519 GCTTGGGCTTTTTCACTGCTTGG - Intergenic
1012294993 6:97510825-97510847 GTTAGTTATTTTTTATTGCCAGG + Intergenic
1012318940 6:97817848-97817870 TTTTTTTTTTTTTTACTGCTTGG + Intergenic
1014728300 6:125000138-125000160 GTTTATTTTTTTTTAGTGCTTGG + Intronic
1015681903 6:135817932-135817954 GTGTGGTATTTCTTTCTCCTGGG + Intergenic
1015682860 6:135827176-135827198 GTTTGATGGTTTTTACTTCTTGG + Intergenic
1016762776 6:147757714-147757736 GTTGGGAATTTTTTAATCCTTGG + Intergenic
1018196934 6:161363508-161363530 TTTTCATATTTTTTACTTCTTGG - Intronic
1018426068 6:163682361-163682383 TTTTCATATTTTTTATTGCTTGG + Intergenic
1018845928 6:167555467-167555489 GTTTGGGTTTTTTTACTGTTTGG + Intergenic
1019226827 6:170518770-170518792 CTTTGTTCTTTTTTACTGTTTGG - Intergenic
1020273185 7:6608982-6609004 GTTTTGTATTTTTTAGAGATGGG + Intergenic
1020437439 7:8180120-8180142 GTTTGGTATGTTTTTCTGGGTGG - Intronic
1020470776 7:8532150-8532172 GGTTGGTATTTTTTACATATTGG - Intronic
1021798472 7:24281632-24281654 GTTTATTCTTTTTTATTGCTGGG - Intergenic
1022237376 7:28474990-28475012 ATTTTGAATTTTTTAATGCTTGG - Intronic
1022433986 7:30360889-30360911 ATTTGGTATTTTTCATTTCTAGG - Intronic
1022561532 7:31354648-31354670 TTTTGGTGCTTTTTTCTGCTTGG + Intergenic
1022752978 7:33251676-33251698 TTTGGGTATTTTCCACTGCTAGG + Intronic
1023066892 7:36387336-36387358 GTTTTGTATTTTTTTAAGCTAGG + Intronic
1023686736 7:42743598-42743620 GTTGAGTATGCTTTACTGCTTGG + Intergenic
1023935989 7:44740105-44740127 GTTTTGTCTTCTTTACTGCAAGG - Intergenic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1024818922 7:53304192-53304214 GTTTGGTATTTTTTTAAGTTAGG - Intergenic
1025227073 7:57175114-57175136 ATTTGGTATTTTTAACTTTTGGG + Intergenic
1025230154 7:57198519-57198541 ATTTGGTATTTTTAACTTTTGGG + Intergenic
1025261467 7:57422238-57422260 GTTGAGTATTTTTTATTGGTAGG - Intergenic
1026042501 7:66879748-66879770 TTTTGGTATTTTTTATTTTTTGG + Intergenic
1028557608 7:92140320-92140342 TTTTGGTATTTTTTAGAGATGGG - Intronic
1028707516 7:93867356-93867378 ATTTTGTATTTTTTTCTACTGGG + Intronic
1028725648 7:94084622-94084644 TTTTGATATTTTTTTCTTCTTGG + Intergenic
1029159165 7:98539439-98539461 GATTGGGATTGGTTACTGCTTGG - Intergenic
1030322229 7:108181286-108181308 ATTTCATATTTTTTACTGATAGG - Intronic
1030727297 7:112940177-112940199 GTTTGGGCTTTTTTACAGCTCGG + Intergenic
1031100082 7:117469247-117469269 GTTCATTACTTTTTACTGCTGGG + Intronic
1031209093 7:118799243-118799265 GTTTTGTATTTCTTATTTCTGGG - Intergenic
1031394400 7:121254530-121254552 GTTATTTATTTTTTTCTGCTAGG - Intronic
1032598362 7:133266007-133266029 GTTTGGTATATTAGTCTGCTTGG + Intronic
1032724560 7:134578614-134578636 GTCTGGCATTTATTACTGCGAGG + Intronic
1033393109 7:140947974-140947996 GTTTGATGTATTTTACTGCCTGG - Intergenic
1034849043 7:154476756-154476778 GTTTTGTTTTTGTAACTGCTGGG - Intronic
1035766939 8:2113858-2113880 GTTTGGTATTTCTCACTGCCAGG + Intronic
1036012674 8:4744798-4744820 GTTTTATGTTTTTTACTCCTTGG - Intronic
1038020567 8:23549066-23549088 GTTTGGAATTTTTTATCGATAGG + Intronic
1039003752 8:33010769-33010791 ATTTGGTATTTTTAACTGTAGGG + Intergenic
1041515434 8:58694446-58694468 GTTTGGTAGGGTTTTCTGCTGGG - Intergenic
1042616155 8:70652070-70652092 GTTTTCTACTTTTTACTGCAAGG + Intronic
1043603597 8:81971778-81971800 TTTTGTTATATTTTACTGGTGGG - Intergenic
1043687381 8:83104837-83104859 GTTTGGTGATTCTTAATGCTTGG - Intergenic
1044609507 8:94078185-94078207 ATTTTGTATTTTTTTCTGCTTGG - Intergenic
1045982538 8:108207968-108207990 CTCTGGTATTTTTTACTTCCTGG - Intronic
1046015586 8:108601035-108601057 GTTTAGTCTTTTTTTCTGATAGG - Intergenic
1046046445 8:108970840-108970862 ATTTGTTATTTTTTTCTGTTGGG + Intergenic
1047876665 8:129145579-129145601 GTTTTGTGTTTTTTATTCCTAGG + Intergenic
1048058948 8:130897450-130897472 GTTTGTTTGTTTTTACTACTAGG + Intronic
1049493897 8:142920069-142920091 GTTTTGTTTTGTTTTCTGCTTGG + Intergenic
1049963658 9:759478-759500 GTTTGTTATTTTTCACGACTTGG - Intergenic
1051825802 9:21217552-21217574 TTATGGTATTTTTTACTAATTGG + Intronic
1052201522 9:25787322-25787344 GTTTGGCACATTATACTGCTTGG + Intergenic
1053187211 9:36026772-36026794 TTTTGTTCCTTTTTACTGCTGGG - Intergenic
1053504935 9:38634191-38634213 GTTTGTTCCTTTTTATTGCTGGG + Intergenic
1055449856 9:76421047-76421069 GTTTGATATTTTTTCCTCATGGG + Intronic
1056380847 9:86055963-86055985 TTTTTGTTTTTTTTACTGTTCGG - Intronic
1056810592 9:89760836-89760858 GTTTGGTTTTGTTTATTGCCTGG - Intergenic
1057623866 9:96660524-96660546 GTGTGGTTTTTTTGACTGGTGGG + Intergenic
1059201843 9:112424719-112424741 GTTTTCTTTTTTTCACTGCTAGG - Intronic
1060775338 9:126369540-126369562 GTTTGGTGTTTTTCATTCCTAGG + Intronic
1188411597 X:29878797-29878819 TTTTGGTATTTTTTAGTGTTTGG + Intronic
1190162197 X:48040859-48040881 GTTTTGTTTTTTTTACAGATAGG + Intronic
1190920167 X:54843224-54843246 GTTAGGTAATGTTTACTGTTTGG - Intergenic
1190961975 X:55260653-55260675 GTTTTTTATTTTTAAGTGCTAGG - Exonic
1192039202 X:67599281-67599303 GTTTGGTTTTGTTTACTGCATGG + Intronic
1192059881 X:67812885-67812907 AATTGGTCTTTTTTACTTCTTGG + Intergenic
1192102117 X:68276009-68276031 GTTTTATATTTTTTTTTGCTGGG - Intronic
1192456406 X:71279958-71279980 TTTTGGTATTTTTTTCTTCCAGG - Intergenic
1192936755 X:75868703-75868725 CTTAGGGTTTTTTTACTGCTAGG + Intergenic
1193366555 X:80640837-80640859 GTTACTTATTTTTTTCTGCTAGG - Intergenic
1193924718 X:87469739-87469761 CTTTGTTATTTGTTTCTGCTTGG - Intergenic
1197092943 X:122559797-122559819 GTTTTGTTTTGTTTTCTGCTGGG - Intergenic
1197434045 X:126402912-126402934 GTATGGAATTTTTTTCTGCCAGG - Intergenic
1200131265 X:153848303-153848325 GTTTGGAATAATTTAATGCTGGG - Intergenic
1201318506 Y:12671761-12671783 TTTTGGTGTTTTTTAATGTTGGG + Intergenic
1201382777 Y:13402067-13402089 GTTTGGCATTTTATGCTGTTTGG - Intronic