ID: 931241647

View in Genome Browser
Species Human (GRCh38)
Location 2:60459505-60459527
Sequence GATGATTAACTAGGACATAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931241647 Original CRISPR GATGATTAACTAGGACATAA TGG Exonic
908012890 1:59800046-59800068 GATCATCAACAAGGACATAGAGG - Intergenic
913433802 1:118826231-118826253 AAAGCTTAACTAGGGCATAAAGG + Intergenic
915305856 1:154977687-154977709 GTTGATTATCTACAACATAATGG - Intronic
919153276 1:193727594-193727616 GATGAATAAGTAGAGCATAAAGG + Intergenic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
1062811410 10:469196-469218 GGTGCATAACTAGGACATCAAGG + Intronic
1063135108 10:3209256-3209278 GATCTTTAAATAGGTCATAAAGG + Intergenic
1063508293 10:6621951-6621973 GTTGTTTAATTAGGAGATAATGG + Intergenic
1069585190 10:69595267-69595289 GAGGATTAATTAGTACAGAAAGG + Intergenic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1071604861 10:86978801-86978823 AAGGATAAACTAGGAAATAAAGG + Intronic
1077947768 11:6921069-6921091 GAAGATAAACTTGGACACAAAGG - Exonic
1078402591 11:11041213-11041235 GATAATTAAATAGCTCATAAAGG - Intergenic
1078945419 11:16062360-16062382 TCTGATTAACTATTACATAAGGG + Intronic
1083451412 11:62748411-62748433 GCTCCTTAACTAGGACATATGGG - Intronic
1086051706 11:82599768-82599790 GATGAGTAACCAAGACTTAAAGG + Intergenic
1088024710 11:105163866-105163888 GATGATCAACCAGTACATCACGG + Intergenic
1091645386 12:2268827-2268849 CAAGATTAACTGGGACAGAAAGG - Intronic
1093645201 12:21578212-21578234 GATGATAATGTAGGACAAAATGG - Intronic
1093965976 12:25325734-25325756 GATGTTTAAATTGGACATAAAGG + Intergenic
1095598935 12:43992857-43992879 AAAGATGAACAAGGACATAAAGG - Intronic
1095676529 12:44925393-44925415 GATAATTAAGTAGGTAATAAGGG + Intergenic
1095737308 12:45571603-45571625 TATTATTAAATAGCACATAATGG - Intergenic
1099591045 12:84590846-84590868 GATGAATTACTAGGTCAGAAAGG + Intergenic
1100904388 12:99280645-99280667 GAAGACTAACTAGAACAAAAAGG + Intronic
1103287962 12:119818751-119818773 GATTATTTCCTAGGACATTATGG - Intronic
1104139767 12:125976124-125976146 GATGATTATCCAGGCCATATGGG - Intergenic
1105775035 13:23651777-23651799 GCTGATTAACTAGAATATACTGG + Intronic
1106518676 13:30477430-30477452 GCTGATTGAATAGGACAGAAAGG + Intronic
1109489850 13:63083085-63083107 GAAGATTAACAAGGAAATAGAGG + Intergenic
1109665218 13:65525946-65525968 GATGTTTAACTAGGTGAGAAAGG + Intergenic
1111460621 13:88536797-88536819 GATGATTAACACCAACATAAAGG + Intergenic
1112722169 13:102257879-102257901 GCTGATGAACTGGGCCATAAAGG - Intronic
1116342864 14:43748316-43748338 GATGATTAAAAATTACATAATGG + Intergenic
1118586962 14:67362436-67362458 TATGTTTGACTAGCACATAATGG + Intronic
1120577484 14:86201202-86201224 GAAGATTAACAAGGACATCCAGG - Intergenic
1123777589 15:23596016-23596038 AATGGTTAACAAGGAAATAATGG - Intronic
1123793469 15:23747653-23747675 GATTAATAACTAGAATATAAGGG - Intergenic
1124268980 15:28263623-28263645 GTTGATTAAATATTACATAAAGG + Intronic
1125388210 15:39161716-39161738 GAGGATTAATAAGGAAATAAAGG - Intergenic
1125388343 15:39163849-39163871 GAGGGGTAACTAGGTCATAAAGG - Intergenic
1127182790 15:56441291-56441313 GATCATATTCTAGGACATAAAGG - Intronic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1129175743 15:73838661-73838683 GAAGGTTAACTATGATATAAGGG - Intergenic
1134033069 16:11008150-11008172 GCTGGTTACCTAGGATATAAGGG - Intronic
1134205119 16:12231205-12231227 GTTGATTAAATAGGATGTAAAGG + Intronic
1137390932 16:48081084-48081106 GGTGATTAATTAGGTCATGAGGG - Intergenic
1141472767 16:84250861-84250883 AATGATTTAATAGGACATATTGG + Intergenic
1144320257 17:14110430-14110452 GATAATTAATTGAGACATAATGG + Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1145066329 17:19763729-19763751 GATGTTTAGCTGGGACATCAAGG - Intergenic
1146246351 17:31286866-31286888 GAAAATTAACTAAGACTTAATGG - Intronic
1147487630 17:40832788-40832810 GAAAATTAACAAGAACATAAGGG + Intronic
1147489456 17:40851484-40851506 GATTGTTAACTAGGCCAAAATGG + Intergenic
1148101817 17:45096918-45096940 GATGAGTAACTAGGCCAAATGGG + Intronic
1155023602 18:21920213-21920235 GATGATTTATTAGACCATAAAGG - Intergenic
1159160265 18:64635449-64635471 AATTTTTAACTAGGACAAAAAGG + Intergenic
1164225347 19:23240526-23240548 GATGCTTAAATGTGACATAATGG + Intronic
928774768 2:34747445-34747467 GATGATAACCTAGGACATTCTGG + Intergenic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
933102544 2:78278743-78278765 TATGATAAACTTGGACTTAAGGG - Intergenic
936958978 2:118053560-118053582 GTTGATTAACTATGACAGATTGG + Intergenic
937386414 2:121437754-121437776 GATGATTGTGCAGGACATAAAGG - Intronic
939221065 2:139302056-139302078 GTTGATTAACTAGTACATTGAGG + Intergenic
944024907 2:195152815-195152837 GTTGAATAAATAGAACATAAAGG - Intergenic
945465704 2:210169049-210169071 GGTGATAAACAAAGACATAATGG + Intronic
1168950879 20:1801144-1801166 AATAATTAACTAGGCCATCAGGG - Intergenic
1170228327 20:14017478-14017500 TATGAATAACTTGAACATAATGG - Intronic
1172156414 20:32828552-32828574 GATGAAGAACTAAGACATTAAGG - Intronic
1172679369 20:36700582-36700604 GATAATTGACTAAGACAAAAAGG - Intronic
1178705497 21:34869485-34869507 GAATATTAAATAGGACACAATGG + Intronic
949141425 3:638023-638045 TAAGATTAATTAGGTCATAAAGG + Intergenic
950072390 3:10163229-10163251 GATTATTAAATAGGGTATAAGGG - Intergenic
951477917 3:23128188-23128210 GATGAATTTCTAAGACATAAAGG - Intergenic
952814811 3:37438018-37438040 CCTGAGTAACTAGGACCTAATGG - Intergenic
955574307 3:60342709-60342731 GATGTTTAACTAAGACTCAATGG + Intronic
958084177 3:88784911-88784933 GATTAATAAATAGGACATAGAGG + Intergenic
959633850 3:108539040-108539062 AAAAAGTAACTAGGACATAAGGG - Intergenic
963658887 3:148098341-148098363 GATTAGCAACTAGGAAATAACGG - Intergenic
965942253 3:174199302-174199324 GATGATTTAATAAAACATAAAGG + Intronic
966745253 3:183268636-183268658 GATGATTACCTAGCACACTAGGG - Intronic
967737556 3:192969407-192969429 GAAGATTAACAAGGATATCAAGG - Intergenic
968720487 4:2199347-2199369 AATGATTAACTTGGGGATAAAGG - Intronic
971204562 4:24551968-24551990 GATGACTATGTAGGATATAAAGG + Intronic
974890721 4:67879106-67879128 AATGATTCCCTAGGACATTAGGG - Intronic
977204278 4:94152561-94152583 GACCATTGACTAGGAAATAATGG + Intergenic
978493636 4:109335084-109335106 GATGATTAAATATGCCCTAAGGG - Intergenic
979758484 4:124371703-124371725 GGTGATTAAAAAGGACAAAAGGG - Intergenic
981128929 4:141136363-141136385 AATGATTATCTATGACATATTGG + Intronic
981305421 4:143241999-143242021 GGTGATAAACTAAGTCATAAGGG + Intergenic
981446057 4:144839268-144839290 GAAGATTAACTAGGATATCCAGG + Intergenic
981490603 4:145335622-145335644 GATCATTATCTATAACATAAAGG - Intergenic
981555927 4:145993700-145993722 AATGATAAACTATGACCTAATGG - Intergenic
981921356 4:150088107-150088129 GATGATGAGCAAGGACATCAGGG - Intronic
989713979 5:44437537-44437559 GAAGAATAACAAGGACATAAAGG - Intergenic
992165866 5:74051003-74051025 GGTGATTAATTAAGACATATGGG + Intergenic
992955443 5:81903491-81903513 GATAATTAGCTTGGACATTAAGG - Intergenic
994920856 5:106040978-106041000 GGTGATTAAATTGGTCATAAGGG - Intergenic
996215300 5:120858681-120858703 GATGGTGAAATAGGAAATAAAGG + Intergenic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000450926 5:161386043-161386065 GCTGAATAACTTGGACATAAAGG - Intronic
1000668672 5:164032350-164032372 CATGATTATCTAGAAAATAATGG + Intergenic
1001129402 5:169051517-169051539 GATAATTAACCAAGTCATAAAGG + Intronic
1003382857 6:5640617-5640639 GATGATTAATTAGCTCAAAAGGG - Intronic
1004070045 6:12289472-12289494 GATGTTTTACTAGGACAAAAAGG - Intergenic
1004587778 6:17019260-17019282 GATGCTCAACTGGGACAGAAAGG + Intergenic
1005525832 6:26647548-26647570 TATGATTAACTATAAAATAAGGG + Intronic
1014974152 6:127857750-127857772 GATGATTTATAAGGACATTAAGG + Intronic
1016096237 6:140041170-140041192 GATGATTATGTAACACATAAAGG - Intergenic
1017177233 6:151516488-151516510 CATGATTTACTAGGACCTCATGG - Intronic
1019878584 7:3838406-3838428 GATGTTTAACTGAGACCTAAAGG + Intronic
1020571150 7:9863637-9863659 GCTGATTATTTGGGACATAAAGG + Intergenic
1021161261 7:17275705-17275727 GAAGATTAACCAGGGCATGATGG - Intergenic
1021247725 7:18284449-18284471 GAAGATGAAATAGGAGATAATGG - Intronic
1021380908 7:19965073-19965095 GTTTATTAACTAAGAAATAATGG + Intergenic
1022915821 7:34950879-34950901 GATGCTTAAATTGGACTTAAGGG + Intronic
1026285176 7:68956564-68956586 GATGATTAACTGCTACTTAATGG - Intergenic
1027818968 7:83018783-83018805 GCTTATTAACAAGGAGATAATGG + Intronic
1030564756 7:111139610-111139632 GATGATTAACTTGCATATCAGGG - Intronic
1031037740 7:116806638-116806660 GAAAATTAACTAGTTCATAAGGG + Intergenic
1031809048 7:126343435-126343457 GTTTATTAACGAGGTCATAAAGG + Intergenic
1033514635 7:142093899-142093921 GATGATTCACTTTGAAATAAAGG - Intronic
1036458774 8:8933192-8933214 GATGAGTAACAAGTAGATAATGG - Intergenic
1037939142 8:22938386-22938408 GATGTTTAAATAGCACATGAAGG - Intronic
1038814716 8:30889618-30889640 GATGAATAATCAGGACACAATGG + Intronic
1039130405 8:34257455-34257477 CATGATTAACTAAGCTATAAAGG + Intergenic
1041943645 8:63417537-63417559 GATGATAAAAGAGGACAGAAAGG - Intergenic
1043228565 8:77768369-77768391 GGTAAATAGCTAGGACATAAAGG + Intergenic
1046824495 8:118672455-118672477 GATCATTCACTAGGATAGAATGG + Intergenic
1048558043 8:135500859-135500881 AATGATTAACTAGGAATTAGTGG + Intronic
1051803910 9:20969314-20969336 TATGATTAATGAGGATATAAAGG - Intronic
1053562870 9:39214086-39214108 AATGATTAATAAGGACATTAAGG + Intronic
1054134277 9:61404966-61404988 AATGATTAATAAGGACATTAAGG - Intergenic
1055202323 9:73681134-73681156 GATGTGAAGCTAGGACATAAAGG - Intergenic
1058945334 9:109850447-109850469 GGTGATAAACTAGGTCAAAAGGG - Intronic
1059183967 9:112247817-112247839 AATGATTAATTTAGACATAAAGG + Intronic
1059549445 9:115214197-115214219 CCTGAGAAACTAGGACATAAAGG + Intronic
1060019905 9:120120252-120120274 AAAAATTAGCTAGGACATAATGG + Intergenic
1060210543 9:121707485-121707507 GATGGTTAACTGGGACAGTAGGG - Intronic
1185836548 X:3349749-3349771 GATGGTTAACTCAAACATAATGG + Intergenic
1187065481 X:15833112-15833134 GATGATAAACTATAATATAAAGG - Intronic
1194319864 X:92432065-92432087 GATCATTAACTACGATAAAATGG - Intronic
1196623606 X:117852416-117852438 GATCATTAACTAGAAGAGAATGG + Intergenic
1200627990 Y:5545198-5545220 GATCATTAACTACGATAAAATGG - Intronic