ID: 931241873

View in Genome Browser
Species Human (GRCh38)
Location 2:60461302-60461324
Sequence CGGGGCGCGGTCGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931241873_931241883 11 Left 931241873 2:60461302-60461324 CCCACGCCCACGACCGCGCCCCG 0: 1
1: 0
2: 2
3: 20
4: 230
Right 931241883 2:60461336-60461358 CGTGGTGGCGCGCCGCCTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 89
931241873_931241881 -4 Left 931241873 2:60461302-60461324 CCCACGCCCACGACCGCGCCCCG 0: 1
1: 0
2: 2
3: 20
4: 230
Right 931241881 2:60461321-60461343 CCCGCGAGCTGTTCTCGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 92
931241873_931241878 -7 Left 931241873 2:60461302-60461324 CCCACGCCCACGACCGCGCCCCG 0: 1
1: 0
2: 2
3: 20
4: 230
Right 931241878 2:60461318-60461340 CGCCCCGCGAGCTGTTCTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931241873 Original CRISPR CGGGGCGCGGTCGTGGGCGT GGG (reversed) Exonic
900207979 1:1439721-1439743 CGGGGCGTGGGCGCGGGCGCGGG - Exonic
900307794 1:2019512-2019534 CGGCGCGGGGTCGGGGGCGGTGG + Intronic
900654335 1:3747466-3747488 CGGGGCGGGGTCTTGGGCGTGGG + Intergenic
901085794 1:6611565-6611587 CTGGGCGTGGTGGTGGGCGCTGG + Intronic
902514064 1:16980535-16980557 CGGGGGGCGGTCAGGGGCGTCGG - Intronic
903149733 1:21398299-21398321 CGGGGAGGGGTGGTGGGGGTCGG - Intergenic
903263563 1:22143506-22143528 CGGGGGGCGGTGGGGGGGGTAGG - Intronic
903642426 1:24869011-24869033 CCGGGCGCGGTGGTGGGCATAGG + Intergenic
904720005 1:32500662-32500684 CGGGCGGCGGCGGTGGGCGTTGG + Intronic
908501234 1:64745276-64745298 CGGGGCGCCCTCGTGCGCTTCGG - Exonic
908796193 1:67833272-67833294 CGGGGCGCGGCGCGGGGCGTCGG - Intronic
910981123 1:92961174-92961196 AGGGCCGCGGTGGGGGGCGTCGG + Intronic
912787630 1:112619664-112619686 TGGGGCGCGGGCGCGGGCGCTGG + Exonic
912972345 1:114295331-114295353 CGGTGCGGGGTGGTGGGAGTGGG - Intergenic
915912728 1:159924600-159924622 CAGGGTGTGGTCGTGGGGGTGGG - Intronic
918229576 1:182515557-182515579 GGGGGCGGGGTGGAGGGCGTGGG + Intronic
922287608 1:224183492-224183514 CCCTGCGCGGTCGTGGGCGCCGG + Intronic
922505187 1:226122029-226122051 AGGGGCGCGGAGGTGGGCGGGGG - Intergenic
1064245681 10:13666048-13666070 CGGGGCCCGGGCGTGGGAGTGGG + Intronic
1064500050 10:15961781-15961803 CTGGGCGTGGTGGTGGGCGCCGG - Intergenic
1065300171 10:24313980-24314002 CTGGGCGCGGTGGTGGGCACTGG - Intronic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1076639085 10:131901521-131901543 CGGGGCACGGGCGGAGGCGTCGG + Intronic
1076879020 10:133230982-133231004 CGCGTCGCGGTCGCGGGCGGTGG - Exonic
1077090720 11:777202-777224 CGGGGCGGGGACGGGGGCGGGGG - Intronic
1077214542 11:1389987-1390009 CGGGGCGCGGGCCTCGGCGGCGG + Intronic
1079329374 11:19521091-19521113 CGGGGCGTGGTGATGGGCCTTGG + Intronic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1084072510 11:66745304-66745326 CGGGGCGGGGTGGGGGGAGTCGG + Intronic
1084295931 11:68213438-68213460 CGGGGCGCGGGGGCGGGCGCCGG - Intronic
1085396166 11:76208206-76208228 CGTGGCGCGTTCCTGCGCGTGGG + Intronic
1086290775 11:85306713-85306735 CCGGGCGTGGTGGTGGGCGCTGG - Intronic
1090699074 11:129278915-129278937 CGGGGCGCGGGCGCGGGAGGCGG + Intronic
1091241727 11:134057376-134057398 CCGGGCGTGGTGGTGGGCGCCGG + Intergenic
1091545413 12:1498510-1498532 CGAGGCGCGGCCGTGGCCGCAGG + Intergenic
1092156037 12:6282085-6282107 CGGGGCGCAGTCGTGAGTGAGGG - Intergenic
1096781449 12:53994539-53994561 CGGGGCGCGGCGGTCAGCGTGGG + Intronic
1098320802 12:69240686-69240708 CGGGGCCCGGGGGTGGGGGTGGG - Intronic
1102896093 12:116599748-116599770 TGGGGCGGGGTGGGGGGCGTGGG - Intergenic
1104056920 12:125237589-125237611 CTGGGCGTGGTGGTGGGCGCTGG - Intronic
1104376181 12:128267093-128267115 CGGGGCCCGGGCGGGGGCGGGGG + Intergenic
1104854567 12:131895707-131895729 GGGGGAGGGGGCGTGGGCGTGGG + Intronic
1104854569 12:131895713-131895735 GGGGGCGTGGGCGTGGGCGTGGG + Intronic
1105004168 12:132710822-132710844 CGGAGCGCCGTCGGGGCCGTGGG + Exonic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1107481447 13:40789385-40789407 CGGGAAGCGGAAGTGGGCGTGGG - Intergenic
1108396759 13:49997295-49997317 CGGGGCACTGTCATGGGCCTGGG + Intronic
1110706156 13:78603173-78603195 CGGGCCGGGGCCGCGGGCGTGGG + Intronic
1113541930 13:111115703-111115725 GGGGGCGCGGGCGGGGGCGCGGG - Intronic
1113656008 13:112068121-112068143 ATGGGCGTGGGCGTGGGCGTGGG + Exonic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1117315402 14:54567103-54567125 AGGGGCGCGGGGGTGGGGGTGGG - Intronic
1120881298 14:89417017-89417039 CGGGGGGCGGCCGCGGGCGCGGG + Intronic
1122840782 14:104461631-104461653 CGGGGCGGGGGGGTGGGCGGGGG + Intergenic
1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG + Exonic
1122975344 14:105168587-105168609 CGGCGCGCGGGCCTGGGCGGCGG + Exonic
1123037768 14:105478374-105478396 CGCGGCGCGGGCGGGGGCGGGGG + Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1124790111 15:32718787-32718809 CGGGGCGCGGCCCTGGCCGCGGG + Intronic
1125603635 15:40928393-40928415 CAGGGCGCGGCCGGGGGCTTGGG + Intergenic
1126281666 15:46958952-46958974 CCGGGCGCGGTGGCGGGCGCCGG - Intergenic
1129423991 15:75451706-75451728 CGGGGCGGGGTCGGGGGAGTGGG - Intronic
1130622002 15:85473239-85473261 CTGGGCGCGGGTGTGGGGGTGGG + Intronic
1132512922 16:352972-352994 CGGGGCGGGGCCTCGGGCGTGGG + Intergenic
1132969859 16:2681881-2681903 CCTGGCGCGGTGGTGGGCGCCGG - Intergenic
1133220195 16:4316354-4316376 CGGGGCGCGGACGCGAGCGGGGG - Intronic
1133257601 16:4526892-4526914 CAGGGCAGGGTGGTGGGCGTGGG - Intronic
1134121290 16:11586714-11586736 CGAGGCGCGGCGGAGGGCGTGGG - Intronic
1134627613 16:15733683-15733705 CCGGGCGTGGTGGTGGGCGTCGG - Intronic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1136855776 16:33656018-33656040 CGGGGCGCGTTTCTGGGTGTAGG - Intergenic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1141989751 16:87602999-87603021 CGGAGCGCGGTCTCGGGCGCGGG - Exonic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1203117361 16_KI270728v1_random:1504499-1504521 CGGGGCGCGTTTCTGGGTGTAGG - Intergenic
1144851684 17:18247127-18247149 CGGGGCGCGGGGGGGGGGGTGGG - Intronic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1147382216 17:40062769-40062791 CGGGGCGCGGCAGGGGGCGGGGG + Intronic
1149691138 17:58577888-58577910 GTGGGCGTGGGCGTGGGCGTGGG + Intronic
1150210405 17:63438450-63438472 TGGGGGGCGGGCGGGGGCGTGGG - Intronic
1150291677 17:63985895-63985917 GGGGGCGTGCTCGTGGTCGTGGG - Intergenic
1150318363 17:64188671-64188693 CCGGGCGTGGTGGTGGGCGCCGG + Intronic
1151611912 17:75182254-75182276 CGGGCCGCCGTCCTGGGCCTGGG - Intergenic
1151780275 17:76240671-76240693 CGCGGCGGGGGCGTGGGCGTGGG + Intergenic
1151802034 17:76384475-76384497 CGTGGCCCGGCCGTGGGCGCGGG + Intronic
1152406117 17:80098830-80098852 CCGGGCGTGGTGGTGGGGGTGGG + Intronic
1152570517 17:81119463-81119485 AAGGGAGCGGGCGTGGGCGTGGG + Exonic
1153688157 18:7567085-7567107 CGGGGCGAGGAGGTGGGCGGGGG + Exonic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1155979088 18:32162224-32162246 CTGGGCGTGGTAGTGGGCGCCGG - Intronic
1157279103 18:46334191-46334213 CGGGGCGCGGGCGCGGGCGGCGG - Intronic
1157376987 18:47176151-47176173 CGGGGCGCGGGCTGGGGCGGCGG - Intronic
1159244377 18:65786396-65786418 GGGGGGGCGGTTGTGGGCTTAGG - Intronic
1160024796 18:75208806-75208828 CGGGGCGAGAACGGGGGCGTGGG + Intronic
1160630977 18:80246617-80246639 GGGGGCGCGCCCGTGGGGGTGGG + Intronic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160787687 19:908890-908912 CGGGGGGCGGCGGTGGGCGGGGG - Intronic
1160807898 19:1000673-1000695 CGAGGCGGGGTCGCGGGCGGGGG - Exonic
1160887010 19:1354849-1354871 CGGCGCGCGGCCGTGGACGCCGG + Intronic
1161005620 19:1934657-1934679 CTGGGCGTGGTGGTGGGCGCCGG + Intergenic
1161203685 19:3029343-3029365 CGGTGCGCGGGGGTGGGCGCGGG - Intronic
1161234781 19:3192437-3192459 AGGGGCGGGGTCGTGAGCCTCGG - Intronic
1161284944 19:3464040-3464062 CGGGGCGCGGGGGTGGGCTCTGG + Intronic
1161973377 19:7596129-7596151 CGGGCCGCGTTCGGGGGCGCAGG + Exonic
1161998904 19:7730999-7731021 GGGGGCGCGGTCGAGGCTGTGGG - Intronic
1162079354 19:8209296-8209318 CGGGGCGGGGCCGTGGGGGCGGG - Intronic
1162312161 19:9913958-9913980 CGGGGGGCGGGCGAGGGCGTGGG - Intronic
1163593169 19:18205400-18205422 CGGTGCGGGGACGTGGGGGTGGG - Intergenic
1163635571 19:18435729-18435751 TGGGGCGCGGGCGCGGGCGCGGG - Intronic
1164146997 19:22518308-22518330 CTGGGCGTGGCCGTGGCCGTGGG + Intronic
1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG + Exonic
1165255026 19:34571626-34571648 CCGGGTGTGGTGGTGGGCGTCGG + Intergenic
1165420071 19:35718091-35718113 CGGGGCGCCGGCGGGGGCGGGGG + Exonic
1165461097 19:35944906-35944928 GGCGGGGCGGGCGTGGGCGTGGG - Exonic
1165489196 19:36113624-36113646 CAGGGCGCGGTGCTGTGCGTAGG - Exonic
1165837818 19:38770261-38770283 AGGGCCGCGGTCGGGGCCGTCGG + Intergenic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
1166876684 19:45901936-45901958 CGGGGGGCGGGCGGGGGCGACGG + Intronic
1166984082 19:46649381-46649403 CTGGGCGTCGTCGTGGGAGTCGG - Exonic
1167045367 19:47046135-47046157 GGGGGCGCGGCCGTGGGCGCGGG - Exonic
1167505274 19:49867831-49867853 AGGGGCGCTGTCGGGGGCGGAGG - Intronic
1167709944 19:51104400-51104422 CCCGGCGCGGTGGTGGCCGTGGG - Exonic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927751454 2:25673711-25673733 CGGGGCGCGGCCGCGGGGGCGGG - Intergenic
928607991 2:32961801-32961823 CCGGGCGTGGTGGTGGGCGCCGG + Intronic
929787341 2:45002116-45002138 CGGGGCGCCGGGGTGGGGGTGGG + Intergenic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
938338981 2:130523010-130523032 GGGGGCGCGGGAGTGGGCGCCGG + Intronic
938350857 2:130597740-130597762 GGGGGCGCGGGAGTGGGCGCCGG - Intronic
940473229 2:154126490-154126512 CTGGGCGTGGTGGTGGGCGCCGG + Intronic
940664705 2:156594141-156594163 TGGGGGGCGGTGGTGGGCGGTGG - Intronic
943571609 2:189581080-189581102 CGGGGGGCGGCCGTGGGGCTGGG + Intronic
944819816 2:203419250-203419272 CGGGGCGCGGTGGTGGGCGCCGG - Intronic
946247491 2:218396102-218396124 CGGGGCGGGATGGCGGGCGTCGG - Exonic
947046194 2:225989526-225989548 CCGGGCGTGGTGGTGGGCGCCGG + Intergenic
947800785 2:232927742-232927764 CGGGGCCCGGGGGTGGGAGTAGG + Intronic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
948645219 2:239400430-239400452 CGGGGCGGGGGCGCGGGGGTGGG - Exonic
1168811893 20:710039-710061 CGGGGCGGGGGCGCGGGCCTCGG - Intergenic
1168883332 20:1225841-1225863 CGGGGCGGGGCAGTGGGCGATGG - Intergenic
1168883354 20:1225901-1225923 CGGGGCGGGGCAGTGGGCGAGGG - Intergenic
1170524990 20:17228081-17228103 GGGTGGGCGGTCGTGGGCGGGGG - Intronic
1170969880 20:21105958-21105980 CGGGGCGGGGTCGGGGGGATGGG + Intergenic
1172661330 20:36571105-36571127 CTGGGCACGGTGGTGGGCGTGGG + Intergenic
1173728420 20:45312463-45312485 TGGGGCGCGGAGGTGGGGGTAGG + Intronic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1175921237 20:62451444-62451466 CCGGGCGCGGTGGGGGGCCTAGG - Intergenic
1176233350 20:64042786-64042808 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1176233423 20:64042932-64042954 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1176233451 20:64042994-64043016 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1176875650 21:14124405-14124427 CGGGGCGGGGTCGGGGGAGGTGG - Intronic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179189040 21:39107831-39107853 CAGGGCGCAGTGGTGGGTGTTGG - Intergenic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1179561557 21:42219090-42219112 CGGGGCGGGGTCGGGCGCGCTGG + Intronic
1180843604 22:18970363-18970385 GGGGGCGCGGGCCTGGGCGGGGG - Intergenic
1182586341 22:31346154-31346176 CGGGGCGCGCACGGGGGCGGTGG + Exonic
1183066709 22:35368511-35368533 CTGGGCGTGGTCGGGGGAGTTGG - Intergenic
1183326916 22:37199319-37199341 CGTGGCGCTGTCGTGGATGTAGG - Intronic
1183683647 22:39349843-39349865 CGGGGCGCGGGCGGGGGGCTGGG - Intergenic
1184023088 22:41833722-41833744 CGACGCGCGGTCGCGGGCGGCGG - Intronic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
949260557 3:2099034-2099056 GGGGACGCGGTCGCGGGTGTGGG + Intronic
950721311 3:14884653-14884675 CAGGGCACGGTGGTGGGAGTTGG + Intronic
951728321 3:25783596-25783618 AGGGGCGGGGTCGGGGGCCTGGG + Intronic
954305704 3:49724216-49724238 CGGGGCGAGGCCGGGGCCGTGGG - Intergenic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
955697751 3:61653889-61653911 CGGGGAGCGGTGGGGGGCGCGGG + Intronic
958153469 3:89722249-89722271 AGGGGCGCGGTGGCGGGCGCCGG - Intergenic
959501791 3:107114868-107114890 CTGGGCGTGGTGGTGGGCGCAGG + Intergenic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
961003049 3:123386775-123386797 CGGGGTGGGGTCGGGGGCGCTGG - Intronic
961414648 3:126748450-126748472 CTGGGCGTGGTGGTGGGCGCTGG + Intronic
968186960 3:196639633-196639655 CGCGGCGCGGGCGCGGGGGTGGG - Intergenic
968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG + Intergenic
968908020 4:3463458-3463480 GGGGGCGCGGGCGCGGGCGGCGG + Intronic
971257884 4:25030721-25030743 CGCGGCGCGGCGGTGGGGGTCGG - Exonic
971989933 4:33879837-33879859 CCGGGCGTGGTGGTGGGCGCTGG - Intergenic
972396569 4:38663865-38663887 CGCGGCGCGGCCGTGGGGCTGGG - Intergenic
972519046 4:39836581-39836603 CCGGGTGTGGTCGTGGGCATGGG - Intronic
973246746 4:48017380-48017402 GGGGCCGCGGGGGTGGGCGTTGG + Intronic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
976781223 4:88760842-88760864 GGGGGAGGGGTCGTGGGCGGGGG + Intronic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984888797 4:184473673-184473695 CGGGGTCGGGTCGCGGGCGTCGG - Intronic
985895625 5:2748794-2748816 CGGGGCGCGGCCTCGGGCGGGGG + Exonic
987049811 5:14140025-14140047 CCGGGCCTGGTGGTGGGCGTCGG - Intergenic
987600097 5:20056824-20056846 CCGGGCGTGGTGGTGGGCGCCGG - Intronic
988949382 5:36241806-36241828 CGGGCCGCGGCCGCGGGCTTGGG + Intronic
990499686 5:56383905-56383927 CGGGGCGGGGCCGCGGGGGTGGG - Intergenic
991046073 5:62224129-62224151 CGGGGCGCGTTTCTGGGTGTAGG + Intergenic
994173122 5:96680204-96680226 CCAGGCGTGGTCGTGGGTGTGGG + Intronic
995241020 5:109885323-109885345 CGAGGCGCCGGCCTGGGCGTGGG - Intergenic
995510948 5:112908684-112908706 GTGGGCGCTGTCGTGGTCGTGGG - Intronic
996538275 5:124601557-124601579 CTGGGCGTGGTGGTGGGCGCCGG - Intergenic
997539302 5:134648622-134648644 CCGGGCACGGTCGTCGGGGTCGG + Intronic
998018852 5:138753390-138753412 CGGGCCGGGGGCGGGGGCGTGGG + Intronic
1000071412 5:157743982-157744004 CGGGGCGCGGCCGCGGGCTCTGG + Exonic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1004562474 6:16762561-16762583 AGGGGCGGGGTGGTGGGAGTCGG - Intergenic
1005512126 6:26520862-26520884 CGGGACGGGGGCGGGGGCGTGGG - Intergenic
1007521392 6:42453367-42453389 CGCGGCGCGGGCGGGGGCGGAGG + Intergenic
1007775733 6:44223492-44223514 GGGGGCGGGGCCGCGGGCGTCGG + Intronic
1009994117 6:70880074-70880096 CGGGGCGTGGGGGTGGGGGTGGG + Intronic
1013819077 6:114134004-114134026 CGGGGAGCGGTAGTGGGAGGCGG + Intronic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1019466910 7:1194780-1194802 CTGGGCGTGGTGGTGGGCGCTGG + Intergenic
1019989629 7:4682492-4682514 CCGGGCGCGATCGCGGGCGCGGG + Exonic
1022528266 7:31052184-31052206 GGGGGCGCGGTGGGGGGCGCCGG - Intergenic
1023948146 7:44819939-44819961 CTGGGCGTGGTGGTGGGCGCGGG + Intronic
1024043823 7:45574465-45574487 CGGGGCGCGGGCGGCGGCGCCGG - Intronic
1024262411 7:47582196-47582218 CGGGGCGCGGGCGCGGGGGCCGG - Intronic
1026236955 7:68535160-68535182 CGGGGGGAGGTGGTGGGCGGGGG + Intergenic
1029537105 7:101163326-101163348 CGGGGAGCGGACGTGGGTGGGGG + Exonic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1035212103 7:157336537-157336559 TGGGGCGCGGGCGCGGGCGCGGG - Intronic
1037688084 8:21160927-21160949 CGGGGCAGGGTCCTGGGAGTTGG - Intergenic
1041355380 8:56993909-56993931 CGGGGCGAGGGCGAGGGCGAGGG + Intergenic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1041690360 8:60680320-60680342 CGGGGCTCGGGCGGGGGCGCGGG + Intronic
1047963009 8:130024520-130024542 CGGGGCGGGGTGGCGGGGGTGGG - Intergenic
1056126327 9:83538759-83538781 CAGGGCGCTGTCGAGCGCGTTGG - Intergenic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1056970036 9:91194000-91194022 CGAGTCGCGGTCGGGGGCCTTGG + Intergenic
1057596413 9:96418748-96418770 CGGGGCGGGGTCGGGGGGGGTGG + Intergenic
1057801301 9:98192768-98192790 AGGAGCGCGGTCGGGGTCGTGGG - Intergenic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1060888833 9:127175540-127175562 CAGGGAGAGGTCGGGGGCGTGGG + Intronic
1060984106 9:127809902-127809924 CGGGGCGGGGTCGTGGGGAAGGG + Intronic
1061275930 9:129569278-129569300 GGGGGCGCGGGCGCGGGTGTGGG + Intergenic
1062277277 9:135736913-135736935 CAGGGCGCTGTGGTGGGCTTAGG - Intronic
1062367309 9:136216985-136217007 CGGAGCGAGGCCGTGGGCGCAGG - Intronic
1062491804 9:136808390-136808412 CGCCGCGCGGTGGTGGGTGTCGG + Intronic
1062556094 9:137114091-137114113 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062556111 9:137114132-137114154 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062556128 9:137114173-137114195 CCGGGCGGGGTCGCGGGCGGGGG - Intronic
1062579229 9:137222153-137222175 AGGGGCGCGGGCGCGGGCGTGGG + Intergenic
1185778982 X:2829369-2829391 CGGGGCGCGGGCGTAGGGCTGGG + Intronic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1198534718 X:137574563-137574585 CAGGGCGCGGGAGTGGGGGTGGG - Intronic
1200098169 X:153673824-153673846 CGGGGCGCGGGCGGGGGGCTTGG - Intronic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1200229657 X:154437599-154437621 GTGGGCGGGGTCGTGGGCATCGG - Intronic