ID: 931246634

View in Genome Browser
Species Human (GRCh38)
Location 2:60497950-60497972
Sequence GGATGACCCCATAAAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931246626_931246634 3 Left 931246626 2:60497924-60497946 CCTGGACCCACCGCTTCATTGGC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 104
931246629_931246634 -4 Left 931246629 2:60497931-60497953 CCACCGCTTCATTGGCCGAGGAT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 104
931246628_931246634 -3 Left 931246628 2:60497930-60497952 CCCACCGCTTCATTGGCCGAGGA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 104
931246630_931246634 -7 Left 931246630 2:60497934-60497956 CCGCTTCATTGGCCGAGGATGAC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 104
931246623_931246634 23 Left 931246623 2:60497904-60497926 CCAGGTGATAGAAGGGGGAGCCT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931246634 Original CRISPR GGATGACCCCATAAAGGTCA GGG Intronic
901153805 1:7122261-7122283 GCATGTCCCAATAAAGCTCAAGG - Intronic
901323831 1:8355564-8355586 GGATGGCCCCAGGCAGGTCACGG + Exonic
902222131 1:14973029-14973051 GGGTGACCCCATCTATGTCATGG - Intronic
903944099 1:26951082-26951104 TGCTGTCCCCAGAAAGGTCAAGG - Intronic
906880267 1:49582241-49582263 GGATTGCCCCATAACTGTCATGG - Intronic
910860420 1:91737994-91738016 GGATGAACCCATACATGTCAGGG - Intronic
912419770 1:109535192-109535214 GGATGACCCCACCCAGGTCCTGG + Intergenic
913408819 1:118527527-118527549 TGAAGACCCTATAATGGTCAGGG - Intergenic
915984135 1:160446643-160446665 GGATGAACCCAACAAGGTAATGG + Intergenic
918109001 1:181439510-181439532 GGATGAACCCCTTAAGGACAGGG + Intronic
919203368 1:194388465-194388487 GGATGACTCCATAAAAGAGAGGG - Intergenic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
920860877 1:209705538-209705560 GGATGAAGCCAGAAAAGTCATGG - Intronic
924931187 1:248733665-248733687 GGAAGAGTCCATAAAGGTGAAGG - Intronic
1063384677 10:5608686-5608708 GGAAGGCCCCATGGAGGTCAAGG + Intergenic
1064733916 10:18361183-18361205 GGATGGCTACATAAAGGTAATGG - Intronic
1068997833 10:63227624-63227646 GGATGTTACCACAAAGGTCAAGG - Intronic
1075172631 10:120130027-120130049 GGCTGAGACCCTAAAGGTCATGG + Intergenic
1075441580 10:122484133-122484155 GGAAGCCCCCTGAAAGGTCAAGG - Intronic
1076600523 10:131654407-131654429 GGCTGCCCCCACAAAGGTCAAGG + Intergenic
1081242135 11:40720033-40720055 GGCTGACACTATAAAGGGCACGG - Intronic
1083397094 11:62399704-62399726 AGCTGACCCCAGGAAGGTCAGGG - Intergenic
1083902895 11:65652330-65652352 GAATGACCCCATCATGCTCATGG - Intergenic
1087334528 11:96826462-96826484 GGATTAATCCAGAAAGGTCAAGG - Intergenic
1088529444 11:110792858-110792880 GGAAGACCTCATAAAAGGCACGG - Intergenic
1102547207 12:113665770-113665792 TGTAGACCCCATCAAGGTCAGGG - Intergenic
1106317729 13:28609674-28609696 GAATGACCCAATAAATGTCATGG - Intergenic
1107055852 13:36102587-36102609 GGAGGAACTCATAAAGATCATGG + Intronic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1118904190 14:70011536-70011558 GGATGACCCCTTCAAGGACAGGG + Exonic
1127582572 15:60351186-60351208 GTATGACTCCATGAAGGTAAGGG - Exonic
1129249476 15:74300960-74300982 GGGTGGGCCCATCAAGGTCAAGG + Intronic
1131518902 15:93098796-93098818 GGTTGACCTCATTAGGGTCAGGG + Intergenic
1133487818 16:6237366-6237388 GTCTGACCCTATAAAGGTGAAGG + Intronic
1136482816 16:30553229-30553251 GTCTGACCCCATCCAGGTCAGGG + Intronic
1141406330 16:83796967-83796989 GAATGACCCTATCAAGTTCAAGG - Intronic
1144775640 17:17783314-17783336 CGCTGACCCCAGCAAGGTCACGG - Intronic
1146050040 17:29542768-29542790 GGATGACCCCAGTGAGGTCCTGG - Exonic
1147606873 17:41778588-41778610 GGATGAGCTCATCAAGATCAAGG + Intronic
1147905494 17:43820026-43820048 AGTTGAGCCCAAAAAGGTCAAGG - Intronic
1150092000 17:62334817-62334839 GGATGAACCCACAAAGGACTAGG - Intergenic
1151449740 17:74191213-74191235 GGATGAGCCCATTAAGATGAGGG + Intergenic
1157188386 18:45559950-45559972 GGATCACCACATCAAGGTCATGG + Intronic
1157963908 18:52186951-52186973 GAATGACCTCAGAAAGATCAAGG - Intergenic
1159440983 18:68479608-68479630 AGATGACCCTATAAAGGGCAGGG - Intergenic
1161720579 19:5900079-5900101 TGATTATCCCATAGAGGTCAAGG + Intronic
1165472784 19:36013183-36013205 GGATGTCCTCAGACAGGTCAGGG + Intronic
926918474 2:17916029-17916051 GGCTTACCACAGAAAGGTCAGGG - Intronic
930052103 2:47224469-47224491 GGAGGACCCCAGTAAGTTCAAGG - Intergenic
930842190 2:55859852-55859874 GAATGACCAGAAAAAGGTCAAGG + Intergenic
931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG + Intronic
932384022 2:71313913-71313935 GGAAGACACCATAAAAGTCTGGG - Intronic
932976620 2:76609382-76609404 CCATCACCCCATAAAGGTCTCGG + Intergenic
935040820 2:99425479-99425501 GGTTGTCCCCATGGAGGTCATGG - Intronic
935883329 2:107589097-107589119 GGATGATCCAATTAATGTCAGGG - Intergenic
942501744 2:176598200-176598222 GTCTGACATCATAAAGGTCAAGG + Intergenic
947287099 2:228529025-228529047 GGATGATCCAAGAAAGGTGAAGG - Intergenic
947529673 2:230900885-230900907 GGGTGACCCCATAAAGCTGGAGG - Intergenic
1168952520 20:1812140-1812162 GCATTTCCCCATCAAGGTCAGGG - Intergenic
1173601967 20:44301877-44301899 GGATGTCCGCATAAAAATCATGG + Intergenic
1174286759 20:49479570-49479592 AGATGAGCCCAGAGAGGTCATGG + Intronic
1174545927 20:51325030-51325052 GGATTACCTGACAAAGGTCAAGG - Intergenic
1175188700 20:57197227-57197249 GGAGGAGCCCATAGAAGTCAAGG + Intronic
1179966501 21:44809868-44809890 GGATGACCCAGGACAGGTCAGGG - Intronic
1180131559 21:45830112-45830134 GCATGCCCCCAAAAGGGTCAGGG - Intronic
1181765179 22:25086556-25086578 GGATGCTCCTACAAAGGTCAGGG - Intronic
1184920452 22:47601745-47601767 GAATGGCCCCATTAAGGCCAAGG - Intergenic
950657205 3:14443977-14443999 GGCTGACCTCATGGAGGTCAAGG - Intronic
954454835 3:50592222-50592244 GCATGAAGCCAAAAAGGTCAGGG - Intergenic
957736370 3:84208894-84208916 TGTTGACCCCATAAACGTAATGG - Intergenic
963942942 3:151113357-151113379 GGATGAGACCAGAAAGGTAATGG + Intronic
967488928 3:190066455-190066477 GGATGACACAATAAACTTCAGGG + Intronic
969991884 4:11272993-11273015 GCCTGAGCCCAGAAAGGTCATGG - Intergenic
972274642 4:37545688-37545710 GGATGACAACAGAAAGGTGATGG - Intronic
975617046 4:76256948-76256970 GAATGAGACCAGAAAGGTCATGG + Intronic
978315564 4:107432684-107432706 GGCTCACCCCATAATGGTAATGG - Intergenic
979209362 4:118080443-118080465 GTATGTCACCATGAAGGTCATGG + Intronic
982481544 4:155917843-155917865 GAAGGACCCCATAAAGGCAAAGG + Intronic
984132353 4:175893572-175893594 GGAGGACCCCATGAAGGTGCTGG - Intronic
985914505 5:2907188-2907210 GGATCACCACCTAAAGGTCAAGG + Intergenic
985914511 5:2907221-2907243 GAATCACCACCTAAAGGTCAAGG + Intergenic
985914540 5:2907353-2907375 GGATCACCACCTAAAGGTCAAGG + Intergenic
985914546 5:2907386-2907408 GAATCACCACCTAAAGGTCAAGG + Intergenic
985914553 5:2907419-2907441 GGATCCCCACCTAAAGGTCAAGG + Intergenic
985914589 5:2907584-2907606 GGATCACCACCTAAAGGTCAAGG + Intergenic
987404933 5:17515315-17515337 GGATGCACCCATAAAGGTGCAGG - Intergenic
987412535 5:17629045-17629067 GGATGCACCCATAAAGGTGCTGG - Intergenic
991391680 5:66150756-66150778 GGATGAGGACAGAAAGGTCAAGG + Intronic
992881840 5:81118013-81118035 GGCTGAGCCCAGAAAAGTCATGG - Intronic
995882336 5:116857156-116857178 GATTGACCCCATAAAGGGAAAGG + Intergenic
999212744 5:149904561-149904583 GGATGACTAAAGAAAGGTCAAGG - Intronic
1004141620 6:13023289-13023311 TGAAGCCCACATAAAGGTCAGGG - Intronic
1004307703 6:14515872-14515894 GGGTGCCTCCATAAAGGTCATGG + Intergenic
1009383429 6:63061280-63061302 GGATGCCCCAACAAAGGACAAGG - Intergenic
1013811131 6:114045827-114045849 GCCTGACCCTATTAAGGTCAGGG + Intergenic
1014392243 6:120877140-120877162 GGCAGACCCCATGAAGGCCAAGG - Intergenic
1016513255 6:144866704-144866726 GGCTGAGCCCATCAAGGTTAAGG + Intergenic
1022987675 7:35674831-35674853 GGATGGGCCCAGAAAGGGCATGG + Intronic
1023541292 7:41269431-41269453 GACTGATCCCATAAAGCTCAAGG - Intergenic
1023611568 7:41977193-41977215 GGATGACCCCATAAGCCCCAAGG - Intronic
1024540900 7:50474361-50474383 GAAAGACCCCATGAGGGTCAGGG + Intronic
1029447231 7:100620578-100620600 GGAGGACCCCAGAAAGGGGAAGG + Exonic
1030711900 7:112759309-112759331 TGATGACCCCATGAAGGGGATGG + Intergenic
1034351810 7:150420759-150420781 AGAAGACCCCATAATGGCCAAGG - Intergenic
1035267643 7:157700513-157700535 GGATGACCCGAAAAAAGTAATGG - Intronic
1036801136 8:11793635-11793657 GGATTACCCCACAATGGACATGG + Intergenic
1037278716 8:17211410-17211432 GAGTGACCCCATAAACCTCAAGG + Intronic
1040500224 8:47998837-47998859 GGCTGACCCCTTAACAGTCAAGG + Intergenic
1046493813 8:114987149-114987171 GATTGAGCCCAGAAAGGTCAAGG + Intergenic
1049227190 8:141460580-141460602 GGATGGCCCAAGAAAAGTCATGG + Intergenic
1055629548 9:78209694-78209716 GGATGAGCCCAAGAAGCTCATGG + Intergenic
1061066378 9:128280300-128280322 GGGTGTCCCAAGAAAGGTCAGGG - Intronic
1185869817 X:3655180-3655202 GGATGGCCACATTAAGCTCACGG - Exonic
1189876241 X:45439480-45439502 AGATAACCCCATAAAATTCAAGG - Intergenic
1196437065 X:115684106-115684128 GGAAGTCCCAGTAAAGGTCATGG + Intergenic