ID: 931246778

View in Genome Browser
Species Human (GRCh38)
Location 2:60498678-60498700
Sequence ATCAGTAAAGAGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 551}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931246774_931246778 -2 Left 931246774 2:60498657-60498679 CCCTCTACCTACTCACATAAGAT 0: 1
1: 0
2: 0
3: 15
4: 113
Right 931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG 0: 1
1: 0
2: 5
3: 36
4: 551
931246776_931246778 -9 Left 931246776 2:60498664-60498686 CCTACTCACATAAGATCAGTAAA 0: 1
1: 0
2: 1
3: 12
4: 154
Right 931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG 0: 1
1: 0
2: 5
3: 36
4: 551
931246775_931246778 -3 Left 931246775 2:60498658-60498680 CCTCTACCTACTCACATAAGATC 0: 1
1: 0
2: 1
3: 3
4: 88
Right 931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG 0: 1
1: 0
2: 5
3: 36
4: 551
931246773_931246778 -1 Left 931246773 2:60498656-60498678 CCCCTCTACCTACTCACATAAGA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG 0: 1
1: 0
2: 5
3: 36
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931246778 Original CRISPR ATCAGTAAAGAGAAGGAAGC AGG Intronic
902136671 1:14312269-14312291 ATCTGCAAAGAGAAAGAAACAGG - Intergenic
902822139 1:18949930-18949952 CCCAGAAAAGAAAAGGAAGCAGG - Intronic
903318196 1:22525408-22525430 ATCAGTGAAGAGCAGAGAGCAGG - Intronic
903342174 1:22661352-22661374 ATCTGGAAAGAGCAGGAACCCGG - Exonic
903916368 1:26767501-26767523 ATTTGTAAAGATAAGGAAGCAGG - Intronic
903968646 1:27105026-27105048 ATCTGTAAAGTGAGGGAACCAGG - Intronic
905445344 1:38025125-38025147 ACCAGAGAAGAGAAAGAAGCTGG - Intergenic
905777439 1:40678104-40678126 ATCTCTAAAAAAAAGGAAGCAGG + Intergenic
905860089 1:41344571-41344593 GTCAGGAAGGAGAAGTAAGCTGG - Intergenic
906510839 1:46409791-46409813 ATCAGTGAAGTGGAGGAAGGGGG - Intronic
906801938 1:48745568-48745590 ATAAGCAAAGAGTAGGAGGCAGG - Intronic
906863641 1:49391182-49391204 ATCAGAAATGAGAATGAAGAAGG + Intronic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
908066994 1:60416736-60416758 ATGAGGAAAGAGAAGGGAGGTGG + Intergenic
908351303 1:63287949-63287971 ATCAATAAAAAGAAAGAATCAGG + Intergenic
910150378 1:84135610-84135632 ATCAGTAACAGGAAGAAAGCTGG + Intronic
910794553 1:91084861-91084883 ACCAGTTAGGAGAAGGAAGGAGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
911230177 1:95352743-95352765 AACAATAAAGAAGAGGAAGCTGG - Intergenic
911557198 1:99359513-99359535 TATAGTAAAGAGAAGGAATCAGG + Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912232475 1:107811360-107811382 ATCTGCAAAGTGAAAGAAGCAGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912957037 1:114162048-114162070 ATAAGCAAAGAGTACGAAGCTGG + Intergenic
913174585 1:116262346-116262368 ATCTGTAAGGTGAAGGAGGCTGG + Intergenic
913304814 1:117416996-117417018 ATCAGAAACTAGAAGTAAGCAGG + Intronic
914826645 1:151142368-151142390 ACCAGCAAAAAGAAGGAAACAGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
916100954 1:161392785-161392807 ATCAGAACAGAGGAGAAAGCAGG + Intergenic
916421179 1:164639226-164639248 ATGATTAAAGAGTAGGAAGTTGG + Intronic
916632060 1:166626442-166626464 ATCAGGAAAGAGAAAAAAGTAGG - Intergenic
918132267 1:181639875-181639897 ATGAGTAAAGAGAAGGGGGTTGG + Intronic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919849588 1:201663665-201663687 ATGAGAGAAGAGAAGGAACCAGG - Intronic
920115292 1:203616461-203616483 ATCAGTTGAGAGAGGGATGCTGG + Intergenic
920120902 1:203657313-203657335 AACAGGAAAGAGAAAGAAGAAGG - Intronic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
922227223 1:223655973-223655995 ATCAGAAAGGACCAGGAAGCAGG + Intronic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922701261 1:227762481-227762503 AGCAGTAAACACAGGGAAGCTGG - Intronic
922717654 1:227885647-227885669 ATGGGTAAAGAGAGGGCAGCAGG + Intergenic
923083943 1:230687394-230687416 ATCACTACTGAAAAGGAAGCAGG - Intronic
924808953 1:247384341-247384363 ACCAGTCAGGAGAAGGAAGGAGG + Intergenic
1063530809 10:6829736-6829758 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
1063845121 10:10119042-10119064 GGTAGGAAAGAGAAGGAAGCAGG - Intergenic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064876916 10:20004868-20004890 ATCAGTAAAAAGAGGGCAGAAGG + Intronic
1064947386 10:20806109-20806131 ATTAGAAAAGAGAAGGAATGTGG + Intronic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065490810 10:26279859-26279881 ATTAGGAAACAGATGGAAGCAGG + Intronic
1066395990 10:35022208-35022230 AACAATAAAGAGAAGGAAACAGG + Intronic
1067718203 10:48705543-48705565 ATTTGAAAAGAGAAGGAAACAGG - Intronic
1067977952 10:51047318-51047340 ATAAGTACAGACAAGGAAACTGG - Intronic
1068025540 10:51638713-51638735 ATCATGGAGGAGAAGGAAGCAGG + Intronic
1068130017 10:52885241-52885263 CTCAGAAGAAAGAAGGAAGCCGG - Intergenic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1068586230 10:58802140-58802162 ATAAGTAAAGGAAAGGAAGCAGG - Intronic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069424746 10:68279279-68279301 ACCATGAAAGAGAAAGAAGCTGG + Intergenic
1070191463 10:74115416-74115438 ATAAGTAAATAAAAGGAATCTGG + Intronic
1070673084 10:78391834-78391856 CTCTTTAAAGAGCAGGAAGCAGG - Intergenic
1071357491 10:84812614-84812636 ACCAGTCAGGAGAAGGAAGGAGG + Intergenic
1072011692 10:91307438-91307460 GCAAGGAAAGAGAAGGAAGCTGG + Intergenic
1072592087 10:96835641-96835663 ATCAGTCAAGAGAAACAAACAGG - Intronic
1072947656 10:99825025-99825047 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1073135589 10:101218341-101218363 CTCATTAAAGAGAAGAAAGTTGG - Intergenic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074640443 10:115372813-115372835 ATGAGCAAAAAGAACGAAGCTGG - Intronic
1074747284 10:116547405-116547427 ATTAGTATATAGGAGGAAGCGGG - Exonic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1076026045 10:127114290-127114312 GGCAGTACAGAGAAAGAAGCAGG + Intronic
1077091281 11:779436-779458 AGCAGTATGGAGGAGGAAGCTGG + Intronic
1077852995 11:6093407-6093429 AACAGGAAAGAGAAAGCAGCAGG - Intergenic
1078472267 11:11600148-11600170 ATCAGTTAAGAGAAGAAAGGAGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1079426495 11:20347335-20347357 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1079842580 11:25423177-25423199 ATCAGGCAAGAGAAAGAAACTGG - Intergenic
1080044104 11:27790223-27790245 TCCAGTAAAGTGAAGAAAGCTGG + Intergenic
1080256919 11:30300608-30300630 ATCAGCAAAAAGAACAAAGCTGG + Intergenic
1080704358 11:34676210-34676232 ATCAGAAAAGGAATGGAAGCAGG - Intergenic
1081178677 11:39960130-39960152 ATCACTAATGAGAGGGAAGTAGG + Intergenic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1082789053 11:57335021-57335043 ACAAGTAGAGAGAAGGAAGGAGG - Intronic
1082790852 11:57345934-57345956 ATGAGAACAGAGGAGGAAGCGGG - Intronic
1083417509 11:62535194-62535216 AGCAGGGAAGAGCAGGAAGCAGG + Intronic
1085202342 11:74709153-74709175 ATCAGGGATGAGAAGGAAGAAGG + Intronic
1085265869 11:75237627-75237649 ATCAGTACAGAGAAGGCACCAGG - Intergenic
1085712993 11:78847026-78847048 ATAAGAAAAGATAAGGAAGTAGG - Intronic
1085827379 11:79862218-79862240 AACAGAAAACAGAAGAAAGCAGG + Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086169667 11:83821815-83821837 TTCAGTAGAGAGAAGGAAATTGG - Intronic
1086785356 11:90962864-90962886 ATGAGTAAAAAGAATAAAGCTGG + Intergenic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087178476 11:95119000-95119022 ATCATTAAAAAGAATCAAGCAGG - Intronic
1087724175 11:101698946-101698968 ATCAAAAAAGAGAAGGAATAGGG + Intronic
1088007577 11:104961342-104961364 ACCAGTCAGGAGAAGGAAGGAGG - Intronic
1088456070 11:110034279-110034301 ATGAGGTCAGAGAAGGAAGCAGG - Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089471665 11:118726274-118726296 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1089708183 11:120295840-120295862 GGAAGCAAAGAGAAGGAAGCGGG - Intronic
1091414833 12:272731-272753 ATCAGTAGAGTTAAGGAACCCGG + Intergenic
1091759692 12:3078428-3078450 TTCAGTAAAGAGAAGGGAGCTGG - Intronic
1092265759 12:6979137-6979159 ATCAGTCAAGAGAAGAAAATAGG + Intronic
1092320067 12:7462601-7462623 CTAAGTAAAAAGAATGAAGCTGG - Intronic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092996220 12:13953469-13953491 AGCAGTAAAGAGAAGGGATGGGG - Intronic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093930885 12:24954241-24954263 ATCAGCAGAGAGAGGGAAGCAGG - Intergenic
1094070216 12:26404545-26404567 ATCAGGAAACAGTAGGAAGAAGG + Intronic
1094087690 12:26611567-26611589 AAAAGTAAAGAAAAAGAAGCTGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094675847 12:32619654-32619676 ATCAGTAAAGAAAAGAAATAGGG - Intronic
1095132799 12:38563990-38564012 AACAGTAAAAAGAAAGAATCAGG - Intergenic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1095883815 12:47167634-47167656 AGCAGCACAGAGAACGAAGCTGG + Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096544570 12:52328768-52328790 ATCTCAAAAGAGAAGGAAGGTGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097302034 12:58029217-58029239 ATCAGGAAAATGAAGGAAGAGGG - Intergenic
1097331006 12:58333010-58333032 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1097922194 12:65088262-65088284 ATCAGTTGAGAGAAGATAGCAGG - Intronic
1098131245 12:67352829-67352851 ATCAGGAAAGAAAAAGAAGAGGG - Intergenic
1098552377 12:71777041-71777063 ATCAGTTAAGTGAAGGATACAGG - Intronic
1098973109 12:76876719-76876741 ATCTGCACAGAGAAGAAAGCTGG + Intronic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100429831 12:94521440-94521462 AACAGGAAAGAGAAAGAAGAAGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103165398 12:118766153-118766175 ATAACGAAAGAGAAGGAAACAGG + Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1104303704 12:127590124-127590146 AGCAGTGAAAAGAAGGAATCAGG - Intergenic
1104646178 12:130499103-130499125 AACAGGAAAGAGCATGAAGCAGG + Intronic
1105858004 13:24388534-24388556 AGCAGGACAGAGAAGGAAGAAGG + Intergenic
1105980872 13:25515011-25515033 ATCAGTAGAGTGAGGAAAGCAGG + Intronic
1106688239 13:32085482-32085504 AACACTAAAGAGGTGGAAGCAGG - Intronic
1106742274 13:32657385-32657407 AACAGAAAACAGAAGAAAGCAGG - Intronic
1106787826 13:33124545-33124567 ATCAGTAGAGAGAAAGACACAGG - Intronic
1107542347 13:41403046-41403068 GACTGTGAAGAGAAGGAAGCTGG - Intergenic
1107650978 13:42544560-42544582 ATTAGAAAAGAGATAGAAGCAGG - Intergenic
1108267933 13:48730866-48730888 ATCAGTGGAGAGGAGGATGCAGG + Intergenic
1109393776 13:61726626-61726648 GGCAGTAAAGAGAATGAAGGAGG + Intergenic
1109524979 13:63564342-63564364 CTCTGTAAAGAGAAGGGATCAGG + Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110448497 13:75615812-75615834 TTCACTAAAAAGAAGGAAGGAGG - Intergenic
1110732893 13:78901128-78901150 ATAAGCAAAAAGAAGAAAGCTGG + Intergenic
1112064732 13:95781086-95781108 ATCAGTAAAATGAGTGAAGCAGG - Intronic
1112702112 13:102021822-102021844 ATCATATAAAAGAAGGAAGCAGG + Intronic
1112735008 13:102406614-102406636 AGCAGGACAGAGAAGGAGGCAGG - Intergenic
1113186911 13:107698101-107698123 ATCAGTAAAAAGAATGAGGATGG - Intronic
1113412464 13:110102230-110102252 ATCTGAAAAGGGGAGGAAGCAGG - Intergenic
1114673543 14:24427439-24427461 ATCAGCATTGAGCAGGAAGCTGG + Exonic
1114898187 14:27021068-27021090 ATCAGTAAAGATAATGGAGGTGG + Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115032182 14:28809791-28809813 GTCAGCAAAGAAGAGGAAGCAGG + Intronic
1115140894 14:30169705-30169727 ATCAGTAGAAAGGAGGAAGAGGG - Intronic
1116457322 14:45134462-45134484 CTCAGTAAAGCGGAGGCAGCGGG - Exonic
1117123257 14:52592266-52592288 AACAGCAAAAAGAACGAAGCTGG - Intronic
1117334665 14:54746735-54746757 ATCACAAAAGAGAAGGTAGCAGG - Intronic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118245854 14:64109787-64109809 ATCACTAATGAGAAGGAAAGTGG + Intronic
1118249547 14:64146325-64146347 ATAAGTAAATAGAGGGGAGCTGG - Intronic
1118284448 14:64458737-64458759 AATAGAAAAGAGAAGGAAACAGG + Intronic
1118335879 14:64853253-64853275 ATCAGTAAATAGGTGGTAGCAGG + Intronic
1118527682 14:66663865-66663887 ATCAATAAAGACAAAGAAGAAGG + Intronic
1119839497 14:77781418-77781440 GTCATTAAAGAGAAAGAATCAGG - Intergenic
1121421356 14:93817990-93818012 ACCAGCAGAGAGAGGGAAGCAGG - Intergenic
1122028420 14:98894831-98894853 TTGAGCAAAGATAAGGAAGCAGG - Intergenic
1122173462 14:99897480-99897502 ATAACTAAAGAGAAGGAAGAGGG + Intronic
1123896061 15:24831250-24831272 AACAGTAACCAGAAGAAAGCAGG - Intronic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1124825195 15:33087248-33087270 ATAAGAAAGGAGAAGGTAGCTGG + Intronic
1124924930 15:34062015-34062037 AGCAGTAAAGAGAGGAAAGCAGG - Intronic
1125554733 15:40574482-40574504 ATCAGTAATAAAAAAGAAGCCGG - Exonic
1126557200 15:50002599-50002621 ATCAGTTAAAAGCAGGGAGCAGG + Intronic
1126610618 15:50525998-50526020 ATCAGGAAACGGAAGGGAGCGGG + Intronic
1127488502 15:59440464-59440486 AGCAGAGAAGAGAATGAAGCTGG - Intronic
1127540454 15:59933318-59933340 CTCAGTAATGAGAAGCAATCTGG - Intergenic
1127693252 15:61418619-61418641 AGAAGTAAAGGGAAGGAAGAAGG + Intergenic
1128474089 15:67982170-67982192 TTCAGAAAAGAGAAAGTAGCTGG + Intergenic
1128523021 15:68387935-68387957 TTCAGCAGGGAGAAGGAAGCGGG - Intronic
1128827712 15:70735558-70735580 ATATGTAAAAAGAAGCAAGCTGG - Intronic
1129381365 15:75169583-75169605 ACCAGTCAGGAGAAGGAAGGAGG - Intergenic
1129913496 15:79247420-79247442 CTCAGCAAACAGAAGGAACCAGG - Intergenic
1130657098 15:85799283-85799305 AGCAGAAACCAGAAGGAAGCGGG - Intergenic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131277992 15:90998271-90998293 ATCAGTAATGAGGAGGGTGCTGG + Intergenic
1131280907 15:91020582-91020604 AGTATTAAAGAGAAAGAAGCCGG + Intronic
1131699564 15:94919456-94919478 ATCAGGCAAGAGAGGGAAGATGG - Intergenic
1132003590 15:98205252-98205274 TTGAGCAAAGAGAAGAAAGCTGG + Intergenic
1132645201 16:996207-996229 CTCAGTAACGAGGAGGAACCAGG + Intergenic
1134189287 16:12108832-12108854 ATTAATAAAGAAAAGGAGGCTGG + Intronic
1135112100 16:19698337-19698359 AACAGGAAAGAGGAGGAAGAAGG - Intronic
1135713754 16:24742491-24742513 GTTAGTAAAGGCAAGGAAGCAGG + Intronic
1137516787 16:49151927-49151949 ATGAGTAAAGAGATTGAATCAGG + Intergenic
1137795921 16:51219788-51219810 ATCTTTAAAGAGAACAAAGCTGG + Intergenic
1137807285 16:51319361-51319383 ATCAGAAAAGTGGAAGAAGCAGG - Intergenic
1137882793 16:52069804-52069826 ATCAGTAAAGAAAGGGGATCAGG + Intronic
1138096050 16:54212943-54212965 ATAATGAAAGAGAAGGAAGGTGG - Intergenic
1139311373 16:66030958-66030980 ATCTGTAAAGTGTAGGAAGTAGG - Intergenic
1139338462 16:66250603-66250625 ATTAAAAAAGAGAAGGAAACTGG - Intergenic
1139574868 16:67834674-67834696 ATCAGAAGAGACCAGGAAGCAGG + Intronic
1140175776 16:72658247-72658269 ACCAGAAAAGAGAAGGGAGAGGG - Intergenic
1140324203 16:73985078-73985100 ATCAGTTAAGACAAGAAAGATGG - Intergenic
1141778996 16:86144166-86144188 ATCAGGAAAGAGAGACAAGCTGG - Intergenic
1143031375 17:3969371-3969393 ATCAGTAAAGCAAAGGCAGAGGG + Intergenic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144763308 17:17719552-17719574 ATAAATAAAGCCAAGGAAGCGGG - Intronic
1146518082 17:33504990-33505012 CTCAGTAAAGTGAAGAAAGTTGG + Intronic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147710452 17:42459549-42459571 ATCATTAAAGAGCAGGAGGACGG + Intronic
1147794351 17:43031936-43031958 AACAGCGCAGAGAAGGAAGCTGG - Intergenic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1150137001 17:62701608-62701630 TTCAGTAAAGAGGAGGAGGGAGG + Exonic
1150367040 17:64597905-64597927 ATCAGGAATGAGAATGGAGCAGG + Intronic
1150686417 17:67324741-67324763 GCCAGTAAAGAGTAAGAAGCCGG + Intergenic
1150937966 17:69658348-69658370 AACAGTAAAGAAAGGAAAGCTGG - Intergenic
1152107826 17:78341474-78341496 ATCAAGAAAAAGAAGGAAGTGGG + Intergenic
1154205165 18:12330032-12330054 ATCTATAATGAGGAGGAAGCTGG + Intronic
1155196087 18:23476105-23476127 AACAGTGAAGGAAAGGAAGCAGG + Intronic
1155678795 18:28463767-28463789 ATAAGTAATGAGAAGGCATCAGG - Intergenic
1155716890 18:28954826-28954848 CTAAGTAAAGAGAACAAAGCTGG + Intergenic
1156027660 18:32674034-32674056 ATCAGAAAAGAGAAAGATGTTGG - Exonic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156954618 18:42947195-42947217 ATTAGGAAAGAGAAGGATGTTGG + Intronic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1159019241 18:63129707-63129729 ATCAGCAGAGAGAAGGGTGCTGG - Intronic
1159053613 18:63444019-63444041 ATCAGGGCAGAGAAGCAAGCGGG + Intergenic
1159708548 18:71724309-71724331 ATCTTTAAAGAGAGGGAAGGTGG - Intergenic
1160193294 18:76732875-76732897 ACCAGTCAGGAGAAGGAAGGAGG + Intergenic
1164370898 19:27643515-27643537 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1164770009 19:30801385-30801407 ACCAGTCCAGGGAAGGAAGCTGG - Intergenic
1165239484 19:34453880-34453902 ATCAGTAAAGAGAAGGTTGCTGG - Intronic
1165922287 19:39306957-39306979 ATGAGTAAAGAGAAGAAATCAGG + Exonic
1166289098 19:41850433-41850455 AGCAGGAAACTGAAGGAAGCAGG + Intronic
1167975316 19:53222058-53222080 ATTAGTAAGGTGAAGGAGGCAGG - Intergenic
925519509 2:4726454-4726476 ATTTGTAAAGAGAATAAAGCAGG + Intergenic
925707853 2:6705342-6705364 AACAGAAAAGAAAAGTAAGCTGG + Intergenic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926349427 2:11981921-11981943 TACAGGGAAGAGAAGGAAGCAGG + Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
927381776 2:22487700-22487722 ATCAGTCAAGAGAGGAATGCAGG + Intergenic
928331067 2:30358386-30358408 AACAGAAAAGATAAGGAAGAGGG - Intergenic
928672053 2:33611996-33612018 ACCAGTCAGGAGAAGGAAGGAGG - Intergenic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929319606 2:40526729-40526751 AGAAGTAGAGAGAAGAAAGCGGG - Intronic
929521385 2:42654910-42654932 ATTAGTAGAAAGAAGGAGGCTGG - Intronic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931077376 2:58731169-58731191 CTCAATAAAGAAAAGGAAGAAGG - Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
934670664 2:96210238-96210260 ATCAGTCCGGAGAAGGAAGGAGG - Intergenic
934811540 2:97282985-97283007 CTCAGCAAAAAGAACGAAGCTGG - Intergenic
934826151 2:97424955-97424977 CTCAGCAAAAAGAACGAAGCTGG + Intergenic
934877402 2:97937209-97937231 ATCAATAAAGAGAAAGAAACTGG + Intronic
935305889 2:101735957-101735979 ATCAGTAAATAGAAGGCTGTAGG - Intronic
936559819 2:113527522-113527544 GTCAGGAAAGAAAAGCAAGCTGG - Intergenic
936924618 2:117723593-117723615 AGCAGTGGAGAGAAGGGAGCAGG + Intergenic
937680260 2:124635908-124635930 ATTTGTAAAGAGAAGCAAGTAGG + Intronic
937681210 2:124646809-124646831 TTCAGAAAAGAGAAGGGGGCTGG + Intronic
937776352 2:125781114-125781136 ATCAGCACAGAGAAGGGAGAAGG - Intergenic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
938201120 2:129373923-129373945 ATCAGTAAAGGAAAGTAAGGTGG - Intergenic
940395071 2:153179492-153179514 ATAAGCAAAAAGAAGAAAGCTGG - Intergenic
940516106 2:154685697-154685719 ATCAGTAGATGGATGGAAGCAGG - Intergenic
940710691 2:157160102-157160124 ATCTGTAAAGAGAAGGCAGCAGG - Intergenic
941086381 2:161122957-161122979 AACAGGTAGGAGAAGGAAGCTGG - Intergenic
941447131 2:165616025-165616047 AACAGTGAAGGGATGGAAGCTGG - Intronic
941675375 2:168338291-168338313 ATCAGAAGAGAGAATAAAGCAGG - Intergenic
941840470 2:170077570-170077592 AACAGGAAAGAGAAAGACGCAGG - Intronic
941885684 2:170524892-170524914 ATCAGTAAAGTGACAGAATCAGG + Intronic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942117355 2:172741253-172741275 ATGTGAAAAGAGAAGTAAGCAGG - Intronic
943073588 2:183170318-183170340 AACAGTAAACAGAAAAAAGCAGG - Intergenic
943822347 2:192341518-192341540 AGCACTAAAAAGAAGTAAGCTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945854375 2:215050836-215050858 AGCAGTAAAGAGAAAGAAAGAGG + Intronic
945899859 2:215525617-215525639 ATAAGTAAAGAGGAGGCAACAGG - Intergenic
946554454 2:220839707-220839729 ATCAGTAGAGAGAAAGATTCTGG + Intergenic
947055509 2:226096330-226096352 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
947923004 2:233894477-233894499 ATCAGTAATGATAGGCAAGCTGG - Intergenic
1169315368 20:4586001-4586023 AGAAGAGAAGAGAAGGAAGCTGG + Intergenic
1169743493 20:8919835-8919857 ATCATTAAAGGGAGGGAAGCCGG - Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1173713045 20:45176937-45176959 AACATTAATGAGAAGGAAGTGGG - Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174606582 20:51766543-51766565 ATCATTAAAACGAAGGAGGCCGG + Intronic
1175074959 20:56364419-56364441 ATAAGTGAAGAGAGGGAGGCAGG - Intronic
1175503420 20:59466152-59466174 ATCAATGAAGAGAAAGAAGGAGG + Intergenic
1175599487 20:60261351-60261373 ATCAGTCAGGAGAAGGAACTTGG - Intergenic
1176881997 21:14206635-14206657 ATGAGGAAAGAGAATGAAGGAGG - Intronic
1176923133 21:14713443-14713465 AACAGTAACTAGAAGAAAGCTGG + Intergenic
1177399972 21:20591021-20591043 ATCAGTAAAGAGAAGAAAAGAGG + Intergenic
1178478708 21:32960062-32960084 ATCAGAAAATAGAGGGAAGGTGG - Intergenic
1178781090 21:35604018-35604040 ACAAGCAAAGAGAAAGAAGCTGG + Intronic
1179814524 21:43896799-43896821 AACAGTAAACAAAAGGCAGCTGG - Intronic
1180243647 21:46530539-46530561 ATAAGTCAAGAAAAGGATGCCGG + Intronic
1180838183 22:18942557-18942579 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
1181785932 22:25227177-25227199 AGCAGAAAATAGAAGGAAGAAGG - Intronic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182822739 22:33232706-33232728 AGCAGTAAAGAGAAGAAAGCTGG + Intronic
1182879830 22:33723877-33723899 AACAGGAAAGAGAATGAAGGAGG + Intronic
1183241699 22:36662421-36662443 ATAAGAGAAGAGAAGGAAGCAGG - Intronic
1183802391 22:40177837-40177859 ATCAGGAAAGGGGAGGGAGCTGG - Intronic
1184239122 22:43202607-43202629 AGCAGGAGAGAGAAGCAAGCAGG - Exonic
951228822 3:20152487-20152509 TTCAGTAAAATTAAGGAAGCTGG + Exonic
951273613 3:20658081-20658103 ATCAGAAAGTAGAAGGAAGCAGG - Intergenic
952354967 3:32575517-32575539 ATGAGTAAAGAAAAGGAGACTGG - Intergenic
952839523 3:37632508-37632530 ATAAGAAAAGAGAAAGAAGGGGG + Intronic
954688101 3:52381545-52381567 GTCAGGACAGAGAAGAAAGCGGG + Intronic
954732787 3:52679032-52679054 GTCAGGAAGGAGAAGGAAACTGG - Intronic
955763049 3:62309966-62309988 ATGAGTTTAGAGAAGTAAGCAGG + Intergenic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
957352404 3:79042472-79042494 CTCAGGAAATAGAAGGAACCAGG - Intronic
957992826 3:87649319-87649341 ATAAGTAAAAAGAACAAAGCTGG - Intergenic
958966565 3:100564905-100564927 ATCAGTACTGAGATGGAAGGTGG - Intronic
959107291 3:102079121-102079143 ATGAGTGGAGAGGAGGAAGCTGG - Intergenic
959111327 3:102126378-102126400 ATAAGTAAAGAGGAGGAGACAGG - Intronic
959454401 3:106541049-106541071 ACAGATAAAGAGAAGGAAGCAGG - Intergenic
959457565 3:106581417-106581439 ACCAGAACAGAGAAGGAATCAGG + Intergenic
959594474 3:108114378-108114400 GACAGCAAAGGGAAGGAAGCAGG - Intergenic
960027890 3:113029539-113029561 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
960257442 3:115525962-115525984 ATCAGCCAAGAGGAGGAAGGAGG - Intergenic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
960849284 3:122035621-122035643 AGCAGGAAAGAGAGGGAAGAGGG - Intergenic
960863809 3:122180564-122180586 ATGTGTGAAGACAAGGAAGCTGG + Intergenic
960873557 3:122274898-122274920 ATCAGTCAAGAGGAGGCAGTGGG - Intronic
961297141 3:125894177-125894199 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
963695761 3:148564672-148564694 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
963899813 3:150723463-150723485 AAAAGAAAAGAAAAGGAAGCAGG - Intergenic
965147547 3:164926084-164926106 AACAGAAAAGAGAAAAAAGCAGG - Intergenic
966145815 3:176810824-176810846 ATCTGGAAAGAGAAGTAAGAAGG - Intergenic
966935615 3:184706793-184706815 ACCAGTCAGGAGAAGGAAGGAGG + Intergenic
967026322 3:185567822-185567844 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
969479211 4:7438398-7438420 AACTTTACAGAGAAGGAAGCTGG - Intronic
969929115 4:10613151-10613173 AACAGTAAACAGAATGAATCAGG + Intronic
969966705 4:11003905-11003927 ATCTGTAAAGGGAAGAAAGGAGG + Intergenic
971645075 4:29189019-29189041 AAAAGTAAAAAGAAGGGAGCCGG - Intergenic
971814333 4:31466967-31466989 ACCAGTTGAGAGAAGGAAGGAGG + Intergenic
973088796 4:46105146-46105168 ACAAACAAAGAGAAGGAAGCTGG + Intronic
974109339 4:57508918-57508940 ATGAGTAGGGAGAAGGAAGTAGG - Intergenic
974376149 4:61078948-61078970 CTCAGTAAAAAGAATAAAGCTGG + Intergenic
974542577 4:63257232-63257254 ATCACTGAATAAAAGGAAGCTGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974752234 4:66155921-66155943 ATAATTAAGGGGAAGGAAGCAGG - Intergenic
974782124 4:66565799-66565821 TTCAGTAAAGAGAAGGATAGGGG + Intergenic
974796357 4:66756104-66756126 TTCAGTAAAAAGAACAAAGCTGG + Intergenic
974849930 4:67392024-67392046 ATCAATCAAGAGAAAGAGGCAGG + Intergenic
975642057 4:76510829-76510851 ATCAGTGAAGTGAAGGGAGCTGG + Intronic
975761468 4:77624568-77624590 GTCGGTAAAGGGGAGGAAGCAGG - Intergenic
976104527 4:81602566-81602588 ATCAGAAGAGTGAAGGAAGATGG + Intronic
976971947 4:91114618-91114640 AACTGCAAAGAGCAGGAAGCAGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977453195 4:97224944-97224966 GGCAGGAAAGAGAAAGAAGCAGG + Intronic
977605020 4:98975532-98975554 ATGAGTAAAAAGAACAAAGCTGG - Intergenic
978212520 4:106155719-106155741 ATAATTAAAGAGAAACAAGCAGG - Intronic
978315445 4:107430748-107430770 TTCACTAAAGAGTAGGAAGGTGG - Intergenic
978386517 4:108180890-108180912 AGCAGGGAAGAGAAGGAAGAAGG + Intergenic
979577705 4:122314868-122314890 TTCAGGGAAGAGAAGGAACCAGG + Intronic
980240427 4:130166863-130166885 ATCAGGAAAGGGAAGCAAGTTGG - Intergenic
980619782 4:135285683-135285705 ATTAGTGAAGAGAATGAAGGTGG + Intergenic
981148512 4:141353860-141353882 ATTGGTAAAGAGGAGGATGCTGG - Intergenic
981472504 4:145152680-145152702 ATAAGTAATGCAAAGGAAGCAGG - Intronic
982185735 4:152796410-152796432 AACAGGAAAGAGAAAGAAGAAGG - Intronic
982324643 4:154117803-154117825 GTCAGATAAGAGGAGGAAGCCGG + Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
982395056 4:154907377-154907399 AGAAATAAAGAGAAGGCAGCTGG + Intergenic
982987413 4:162228237-162228259 ATCAATTATGAGAAGGAAACTGG + Intergenic
983079135 4:163363975-163363997 ATCAGGAATGAGAAGGAATTGGG - Intergenic
983413567 4:167426894-167426916 ATAAGTAAAAAGAACAAAGCTGG + Intergenic
983473811 4:168190083-168190105 ATCAGTAAAAAAAATGAAGATGG + Intergenic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
984202889 4:176747860-176747882 GTCAGGAAATAGGAGGAAGCTGG + Intronic
985631334 5:1015620-1015642 ATCAGGAAGCAGGAGGAAGCAGG + Intronic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
986235603 5:5907269-5907291 AACAGTAATGAAAAGAAAGCTGG - Intergenic
986949373 5:13063161-13063183 ATGAGTAAAGTGAAGAAGGCAGG + Intergenic
987282768 5:16427271-16427293 ACCATTAAAAACAAGGAAGCTGG + Intergenic
987318834 5:16749064-16749086 ATCAAGTGAGAGAAGGAAGCTGG - Intronic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988380470 5:30492207-30492229 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
988994055 5:36697650-36697672 ATCAGGATGGAGAGGGAAGCAGG - Intergenic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
989836924 5:46005298-46005320 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
990807715 5:59684744-59684766 CTCAGTAAATACCAGGAAGCAGG - Intronic
991043042 5:62195045-62195067 GGCAGTAATGAGAAGGAAGTGGG + Intergenic
991353802 5:65747411-65747433 ATGAGAATAGAGAAGGTAGCTGG + Intronic
991434232 5:66580124-66580146 ATTAATCAATAGAAGGAAGCAGG - Intergenic
992241100 5:74770699-74770721 AACAGGAAAGAGAAAGAAGAAGG + Exonic
992441443 5:76800951-76800973 ATAAGTAAAGGAAAGAAAGCAGG + Intergenic
992466556 5:77011889-77011911 ATCAGGAGAGAGAAGGAAGGAGG - Intergenic
992783395 5:80148054-80148076 AATAGTAAAGTGAAGGAATCTGG + Intronic
993239473 5:85362413-85362435 ATCAGTAAAGAAAATGTAGGGGG - Intergenic
993648644 5:90490703-90490725 ATCAGGAAACAGAGGTAAGCTGG - Intronic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
994214836 5:97125952-97125974 TTCAGTAAAGAGATGGAGGAGGG + Intronic
994380661 5:99067143-99067165 ATGAGTAAAGAGAAGAAAAATGG + Intergenic
994672274 5:102776949-102776971 ATCAGAAAATACAAGGAAGCAGG - Intronic
994988136 5:106964243-106964265 ATCAATAAAGAGATAGATGCAGG + Intergenic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
996308764 5:122079241-122079263 TTTGGTAAAGAGAAGGAAGTAGG + Intergenic
996533049 5:124546173-124546195 TTCAGTAAGGAGGAGGAAACAGG - Intergenic
997018170 5:129962703-129962725 ACCATCAAAGAGGAGGAAGCAGG - Intronic
997166060 5:131660995-131661017 ACCAGTCAGGAGAAGGAAGGAGG - Intronic
997779825 5:136645239-136645261 AGCAGAAAAGAGGAGGAGGCTGG + Intergenic
997893958 5:137699334-137699356 AACAGTGAGAAGAAGGAAGCTGG + Intronic
998511553 5:142718449-142718471 ATGGGTAAATACAAGGAAGCTGG + Intergenic
998765257 5:145479237-145479259 TTCAGCAAAGAGACAGAAGCAGG - Intronic
998769956 5:145531574-145531596 AACAGGAAAGACAAGGAATCTGG + Intronic
998793756 5:145794620-145794642 ATCTGTAAGAGGAAGGAAGCAGG + Intronic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
999952165 5:156662980-156663002 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1001105997 5:168855005-168855027 AATAGTAAAGAAAAGGAAGCTGG - Intronic
1002295473 5:178228501-178228523 CTCTGGAAAGAGAAGGGAGCTGG - Intronic
1003635970 6:7831884-7831906 CTCAGGAAAGAGCACGAAGCAGG + Intronic
1004024750 6:11807525-11807547 ATTAGAAAAGAGATCGAAGCAGG + Intergenic
1004589126 6:17031750-17031772 AGCAGTAAGGAGAAAGAAGCGGG - Intergenic
1006432406 6:34005718-34005740 AACATTAGAGAGAAGGATGCAGG - Intergenic
1006604929 6:35249277-35249299 ATCTGTATAGACAAGAAAGCTGG - Exonic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1008702309 6:54115792-54115814 AGCAGTAAAGATAAGCAAGGAGG + Intronic
1008886791 6:56440051-56440073 ATCAGTAGAGAGAAGTCAACAGG + Intergenic
1009490979 6:64290365-64290387 AACAGTAGTGAGATGGAAGCTGG + Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010274816 6:73957113-73957135 ATTCCTAAAGAGAAGAAAGCTGG - Intergenic
1010591944 6:77722469-77722491 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1010977373 6:82331100-82331122 ATCTGAAAAGAGAAGAAAGAGGG - Intergenic
1010993862 6:82511091-82511113 TGCAGCAAAGAGAAGGCAGCAGG + Intergenic
1012305626 6:97653574-97653596 AACAGTAAAGATAAGTAAACAGG + Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012713980 6:102645828-102645850 ATAAGTAAATAGAACAAAGCTGG - Intergenic
1013163673 6:107570428-107570450 TTCAGTAAAGCCAAGGAAGGTGG - Intronic
1013854443 6:114554970-114554992 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1014411609 6:121129836-121129858 ATCAGAAAAGAGAAAGCAACAGG + Intronic
1014931339 6:127340326-127340348 CTCAGTAAATAGAATGAAGAAGG - Intronic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015444693 6:133289315-133289337 ATCAGGAAGTAGATGGAAGCAGG + Intronic
1015658728 6:135548714-135548736 ATCAGTAAACAACAAGAAGCTGG - Intergenic
1017196676 6:151708584-151708606 ATCAGGAAAGATTAGAAAGCAGG - Intronic
1017926238 6:158913852-158913874 AACAGCAAAAAGAAGGGAGCTGG - Intergenic
1019902476 7:4032736-4032758 ATTAGAAAAGAAAAGAAAGCTGG + Intronic
1019956295 7:4417261-4417283 ATCAGTGAAGTGGAGGAAGCTGG - Intergenic
1019976620 7:4587992-4588014 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1019977556 7:4596496-4596518 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1020508423 7:9021212-9021234 AGTAGTAAGGAGAAGGGAGCAGG - Intergenic
1020685386 7:11287361-11287383 ATGATTAGAGAGAAGGAAGAGGG - Intergenic
1021114693 7:16734289-16734311 GTCAGTGGAGAGACGGAAGCAGG + Intergenic
1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG + Intergenic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1022009309 7:26294800-26294822 ATCTGTAAAAAGAAAGAAGAAGG - Intronic
1022972553 7:35530911-35530933 AGGAGTAAGGAGGAGGAAGCAGG - Intergenic
1023002562 7:35825942-35825964 ATCAGTAAAAAGAGGAGAGCTGG + Intronic
1023449188 7:40264167-40264189 ATCAGTAAAGGTAAACAAGCAGG - Intronic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023753766 7:43396793-43396815 ATCTGTAAAAAGAAGGAAAATGG - Exonic
1024076953 7:45826023-45826045 ACCAGTGAAGAGCATGAAGCTGG - Intergenic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1024152206 7:46583419-46583441 ATAAGAACAGAGAAGTAAGCAGG + Intergenic
1024169395 7:46768540-46768562 ATCAATCAGGAGAAGGAAGGAGG - Intergenic
1024522092 7:50314693-50314715 GTCAGAAAAGAGAGGGGAGCTGG + Intronic
1024525408 7:50344414-50344436 ATGTGTGAAGAGAAGGAACCTGG - Intronic
1025127468 7:56355394-56355416 ACCAGTGAAGAGCATGAAGCTGG + Intergenic
1025757953 7:64362960-64362982 ATCTGTAAAGAGAAGACAGAGGG + Intergenic
1026231539 7:68488435-68488457 AGCAGTAAAGAGGAGGATGTGGG + Intergenic
1026432173 7:70358373-70358395 AGAAGTGAAGAGAAGTAAGCTGG - Intronic
1026778847 7:73249863-73249885 GTGAGTCAAGAGAAGGAATCTGG - Intergenic
1026808490 7:73443057-73443079 AGCAGCAAAGAGCAGGCAGCGGG + Intronic
1027019707 7:74803271-74803293 GTGAGTCAAGAGAAGGAATCTGG - Intronic
1027068319 7:75142670-75142692 GTGAGTCAAGAGAAGGAATCTGG + Intronic
1027263265 7:76479833-76479855 ATCAGTAGCAAGAAAGAAGCTGG + Intronic
1027314645 7:76977938-76977960 ATCAGTAGCAAGAAAGAAGCTGG + Intergenic
1027613674 7:80394125-80394147 ATCAGTTAAGAGAAGGAACTAGG - Intronic
1028096694 7:86769541-86769563 ATAAGAAAAGAAGAGGAAGCTGG - Intronic
1029966912 7:104749883-104749905 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1030714674 7:112793548-112793570 ATAAGTCAAGAAAAGGAAGAGGG + Intergenic
1031076932 7:117221962-117221984 AGCAGTAAAGAGAATAAAGAAGG - Exonic
1031134065 7:117866663-117866685 ATCAGTAAAAATAAGGATGCTGG + Intronic
1032374767 7:131401569-131401591 AACAGAAAAAAGAAAGAAGCAGG - Intronic
1032673579 7:134107792-134107814 ATCTGCAAAGTGAAAGAAGCAGG + Intergenic
1033774775 7:144596734-144596756 ATCAATAAAAAGAATAAAGCTGG + Intronic
1035260534 7:157659054-157659076 ATCTTTAAAGCCAAGGAAGCCGG - Intronic
1035531731 8:357786-357808 ATCAGCAAGGAGAAGAAAGGCGG - Intergenic
1035890460 8:3337194-3337216 ATAAGTAAGGAGACGGAAGATGG - Intronic
1036292166 8:7503441-7503463 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1036434950 8:8724339-8724361 AGCACTAAAGAGAAGAGAGCTGG + Intergenic
1037602474 8:20409144-20409166 ATGAGTAAAGAAACAGAAGCAGG + Intergenic
1038316532 8:26489185-26489207 ACCAAACAAGAGAAGGAAGCCGG - Intronic
1039240590 8:35551928-35551950 ATCAATAAAGAGAAGGGCGAAGG + Intronic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040468548 8:47717234-47717256 ACCAGTGAAGAGAATGAAGGTGG - Intronic
1040573631 8:48631279-48631301 AACAGTAAGAAGCAGGAAGCAGG + Intergenic
1040687157 8:49888111-49888133 AACAGTAAACAGAAGAGAGCTGG - Intergenic
1040963283 8:53058250-53058272 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1042418403 8:68555083-68555105 ATCAGTAAAGGAAAGGAAATAGG - Intronic
1042761263 8:72273839-72273861 ATGAGCACAGAGCAGGAAGCTGG + Intergenic
1043706616 8:83358447-83358469 ACCAGTCTGGAGAAGGAAGCAGG + Intergenic
1043886977 8:85612291-85612313 ATTAGCAAAGACAGGGAAGCAGG + Intergenic
1044370745 8:91407735-91407757 ATTACCCAAGAGAAGGAAGCAGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045316427 8:101047549-101047571 ACCATTAAAGGGAAGGAAGTTGG + Intergenic
1045533505 8:103005822-103005844 ATCAGGAAAAAGAAGGAATGGGG + Intergenic
1045690081 8:104751386-104751408 AGGAGTAAGGAGAAAGAAGCAGG + Intronic
1045805755 8:106159363-106159385 ATCAGTAGAGACAAGTAACCTGG + Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1047326057 8:123836899-123836921 AATAACAAAGAGAAGGAAGCGGG - Intergenic
1047582300 8:126229432-126229454 AGTTGTAAAGAGAAGGCAGCTGG - Intergenic
1048273696 8:133049677-133049699 CTCAGTAAAATGAAGGAAGTTGG - Intronic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1049609891 8:143550013-143550035 ATAAGAAAAGAGCTGGAAGCTGG - Intergenic
1049893049 9:88850-88872 GTCAGGAAAGAAAAGCAAGCTGG + Intergenic
1049915477 9:313402-313424 ATAAGAAAAGAAAAGAAAGCTGG - Intronic
1049969839 9:812217-812239 ATCGGTTAAGGGAAGGAATCTGG + Intergenic
1050257385 9:3809474-3809496 ATCAGAAAATAAAAGGAGGCAGG + Intergenic
1050384101 9:5066691-5066713 ATTAGTAAACTGAAGAAAGCAGG + Exonic
1050424423 9:5499005-5499027 ATCTGGAATGTGAAGGAAGCAGG - Intergenic
1051555552 9:18378659-18378681 GCCAGAAAAGAGAAGGAAGAAGG - Intergenic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1053734267 9:41088903-41088925 GTCAGGAAAGAAAAGCAAGCTGG + Intergenic
1054694127 9:68342669-68342691 GTCAGGAAAGAAAAGCAAGCTGG - Intronic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1054861856 9:69962065-69962087 ATCAGTAAAGAGAGGTGTGCAGG - Intergenic
1054954159 9:70888948-70888970 ACCAGTATGGAGAAGGAAGTGGG + Intronic
1055856522 9:80694528-80694550 AGCAGGAAAGAGAAGGAGACAGG + Intergenic
1056052955 9:82789059-82789081 AGCTGTAAAGAAAAGGAAACAGG - Intergenic
1056281429 9:85044770-85044792 ATAAGGAAAGAAAGGGAAGCAGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056840191 9:89992507-89992529 ATGAGTCATGAGAAGGGAGCTGG + Intergenic
1058386779 9:104445448-104445470 ATTAGTAGTGAGAAGGAATCAGG + Intergenic
1058530584 9:105901710-105901732 CTCAGGAAAGAGAGGGAGGCAGG - Intergenic
1059593749 9:115693458-115693480 ATAAGAAAAGGGAAGGGAGCCGG - Intergenic
1059805812 9:117799081-117799103 ATGAGTCTAGAGAAAGAAGCAGG + Intergenic
1059968773 9:119642908-119642930 ATCAGGAAAGAGAGTGAAGGGGG - Intergenic
1060209822 9:121702800-121702822 ATCAGGAGAGAGAAGGAATGAGG - Intronic
1060306934 9:122421985-122422007 ACCAGTCAGGAGAAGGAAGGAGG + Intergenic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1062714036 9:137995233-137995255 ATCAGCAAAAAGAACAAAGCTGG + Intronic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186501715 X:10055966-10055988 TACAGTAAAGAGCAGAAAGCTGG + Intronic
1186864149 X:13702247-13702269 ATGAGAAAAGAGGAGGGAGCAGG - Intronic
1188048920 X:25460595-25460617 AGCAGGAGAGAGAAGAAAGCAGG + Intergenic
1188459642 X:30409683-30409705 ATCATTAAACAAAAGAAAGCTGG - Intergenic
1188618031 X:32182709-32182731 ATCAGTAAACAGAAAAAAACAGG + Intronic
1188687256 X:33083936-33083958 ACCAGTCAGGAGAATGAAGCAGG + Intronic
1190500347 X:51070054-51070076 AACAGCAAAGAGAAGAGAGCTGG + Intergenic
1190524247 X:51311890-51311912 ATTAGTAATAAGAAGGAAGGAGG + Intergenic
1191163599 X:57363016-57363038 TTAAGTAAAGAGAACAAAGCTGG - Intronic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1192849428 X:74938988-74939010 CTAAGTAAAAAGAACGAAGCTGG - Intergenic
1192901149 X:75498286-75498308 ATCAGACAAGAGAAAGAAACTGG + Intronic
1193822188 X:86179429-86179451 ATCAGGAGAGAGAAGAATGCAGG + Intronic
1193988701 X:88278877-88278899 CTCAGCAAAAAGAAGAAAGCTGG - Intergenic
1194463283 X:94199215-94199237 CTCAGGAAAGAGAATGCAGCAGG - Intergenic
1194753592 X:97711224-97711246 ATAAGTAAAAAGAACAAAGCTGG + Intergenic
1194934164 X:99927529-99927551 ATAAGTAAAAAGAACAAAGCTGG + Intergenic
1195029345 X:100911119-100911141 AACAGGAAAGAGAAAGAAGAAGG + Intergenic
1195157842 X:102141562-102141584 ATCAGTTCAGAGAAGGTGGCAGG - Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195549781 X:106154385-106154407 AACAGTAATCAAAAGGAAGCTGG + Intergenic
1195781611 X:108472148-108472170 ATCAATAAAAAGAAGAAAGCTGG - Intronic
1196087424 X:111699822-111699844 TTCAGTAAAAAGAACAAAGCTGG - Intronic
1196381425 X:115094566-115094588 ATCAGTAACAAGAGGGAAACTGG + Intergenic
1196467388 X:115986555-115986577 ATAAGCAAATAGAAGAAAGCTGG + Intergenic
1196689812 X:118547337-118547359 ATCACCAAAGGGAAGGCAGCAGG - Intronic
1196945450 X:120820419-120820441 CTCAGTAAAAAGAACAAAGCTGG - Intergenic
1197950238 X:131887299-131887321 ATCAGAAAACAGTAGAAAGCTGG + Intergenic
1198035492 X:132797548-132797570 ATCACTAGAGAGAAGGAATTAGG - Intronic
1198300902 X:135333415-135333437 AGCAGTATAGAGAAGGAAGTAGG + Intronic
1198669374 X:139062489-139062511 TTGAGCAAAAAGAAGGAAGCTGG - Intronic
1198728613 X:139703115-139703137 AGCAGGGAAGAGAAGGAAGAAGG - Intronic
1199144092 X:144345774-144345796 ATAATTAAAAAGAATGAAGCAGG - Intergenic
1199268692 X:145857681-145857703 CTCTGTAGAGAGAAGGATGCTGG - Intergenic
1199541679 X:148964924-148964946 ATCAGGAAAGTGAAAAAAGCGGG + Intronic
1200055682 X:153459052-153459074 ATCAAAAAAGAAAAGGAGGCCGG - Intronic
1200428526 Y:3048775-3048797 CTAAGTAAAGAGAACAAAGCTGG - Intergenic
1201566747 Y:15373162-15373184 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1201749133 Y:17413346-17413368 ACCAGTCAGGAGAAGGAAGGAGG - Intergenic