ID: 931251054

View in Genome Browser
Species Human (GRCh38)
Location 2:60530821-60530843
Sequence GACTCAGGAGGGGTAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 473}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931251054 Original CRISPR GACTCAGGAGGGGTAGTGGG AGG (reversed) Intronic
900439375 1:2645736-2645758 GAATCAGGAGGGATGGTAGGAGG - Intronic
900792993 1:4691856-4691878 GGCTCAGGAGGGGAAGAGGCAGG - Intronic
900894111 1:5470879-5470901 GACACAGGTGGGGTAGTAGCTGG + Intergenic
901018448 1:6244451-6244473 GACTCAGGCGGGGTGGGGGTGGG + Intronic
901192088 1:7418691-7418713 GACTCAGGAGGGGAAGTTCAGGG - Intronic
902279617 1:15364902-15364924 GACTCAGGATGGTTGATGGGAGG - Intronic
902693771 1:18126804-18126826 GGCTCTGGAGGGGGTGTGGGGGG - Intronic
902987868 1:20166412-20166434 GAGGCAGGAGGGGGAGTGGGAGG - Intronic
903058608 1:20654139-20654161 GACTCAGAAGGGGAAGAAGGAGG - Intronic
903231670 1:21926120-21926142 GCATCAGGAGGGGGAGTTGGGGG - Intronic
903714463 1:25354098-25354120 TACTCAGGAGGCTGAGTGGGAGG - Intronic
903888876 1:26556769-26556791 GCCACAGGAAGGGTGGTGGGAGG + Intronic
904285266 1:29449849-29449871 GACTCTGGAGGGGTCCTGGTTGG - Intergenic
905142863 1:35862365-35862387 GACTCAGAAGGGGTCCTGGAGGG - Intergenic
905313250 1:37065190-37065212 GGCTCAGGGAGGGGAGTGGGAGG - Intergenic
905328243 1:37173828-37173850 GACTTAGGTGGGGTATGGGGAGG + Intergenic
905428450 1:37902872-37902894 TACTCAGGAGGTGAAGGGGGAGG + Intronic
905466245 1:38155847-38155869 GACTCGGGCGGGGTTGGGGGTGG + Intergenic
905740902 1:40370698-40370720 GACTGTGGTGGGGTAGGGGGAGG + Intronic
906790863 1:48657634-48657656 GAGTCATGAGGTGCAGTGGGTGG + Intronic
906936363 1:50217346-50217368 GCCTCAGGAGAGGGAGAGGGTGG + Intergenic
907059123 1:51403145-51403167 TACTCAGGAGGTGAAGTAGGTGG - Intronic
907203748 1:52751087-52751109 TACTCAGGAGCTGAAGTGGGAGG - Intronic
908358207 1:63342899-63342921 TACTCAGGAGGCCAAGTGGGAGG - Intergenic
909237808 1:73175875-73175897 TACTCAGGAGTGGAGGTGGGAGG - Intergenic
909811627 1:79938536-79938558 GACTGTGGTGGGGTAGGGGGAGG - Intergenic
910723905 1:90317437-90317459 GACTGAGGAGGGGTAGGTGTAGG - Intergenic
910842108 1:91570822-91570844 TACTCAGGAGGTTGAGTGGGAGG + Intergenic
910861304 1:91744691-91744713 GAATCATGAGTGGTAGAGGGAGG - Intronic
911584614 1:99676541-99676563 GACTCAGAAGGGTGAGAGGGTGG - Intronic
911735720 1:101334629-101334651 GACTCAGAAGGGGGAGAGGGAGG - Intergenic
913014754 1:114721696-114721718 GACTCAGGAGCTGAGGTGGGAGG - Intronic
914330327 1:146663481-146663503 GTCTCAGGTGGGGTTGGGGGTGG - Intergenic
915200074 1:154220836-154220858 GACGCAGGAAGGCAAGTGGGCGG + Exonic
916149375 1:161771564-161771586 GAATCAGGAGAGGTAGAGGATGG - Intronic
916161813 1:161923972-161923994 GACTTTGGAGAGTTAGTGGGAGG - Intronic
916410540 1:164542931-164542953 GACTCAGGAAGGGGTGGGGGTGG - Intergenic
916556382 1:165897451-165897473 GACCCAGCAAGGGCAGTGGGTGG + Intronic
917755447 1:178093962-178093984 GCCTGAGGAGGGGTAGGGGGCGG - Intergenic
918487739 1:185046303-185046325 TACCCAGGAGGAGTCGTGGGGGG + Intronic
918577530 1:186080883-186080905 AACTCAGAAGGTATAGTGGGAGG + Intronic
919193770 1:194257122-194257144 GACTGTGGTGGGGTAGGGGGAGG - Intergenic
920107739 1:203566313-203566335 GGCGCAGGAGGGGCAGAGGGAGG + Intergenic
921544634 1:216459997-216460019 GACTCATTAGATGTAGTGGGTGG - Intergenic
922329170 1:224558624-224558646 GACTAAGGAGGAGGAGTGGTGGG - Intronic
922513747 1:226190887-226190909 GACTCAGTAGGTATAGAGGGAGG + Intergenic
923126776 1:231040293-231040315 GGCGCGGGAGGGGAAGTGGGCGG - Intergenic
923459252 1:234194436-234194458 GACTCAGGAGAGAGGGTGGGAGG + Intronic
924155204 1:241168241-241168263 GATTCAGGAGGGATAAAGGGGGG + Intronic
924835052 1:247639426-247639448 AGCTCAGGAGGCGGAGTGGGAGG + Intergenic
1065268288 10:23999955-23999977 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1066819952 10:39472673-39472695 GACTGTGGTGGGGTAGGGGGAGG + Intergenic
1067337586 10:45377678-45377700 GACTAATGAGGGGCTGTGGGAGG - Intronic
1067840248 10:49670078-49670100 GACTCAGAAGGGGGAGTGTGGGG - Intergenic
1067877059 10:50016589-50016611 GACTGAGGAGGGGGAGGAGGAGG - Intergenic
1068750521 10:60586534-60586556 GACTCTGGAGGAGTAGGGGAGGG + Intronic
1068866971 10:61904092-61904114 AAATCAGGAGGGGGAGAGGGAGG - Intronic
1069242227 10:66157192-66157214 GACTTGCGAGGAGTAGTGGGAGG - Intronic
1069461511 10:68599461-68599483 GGCTTAAGAGGGGTCGTGGGGGG + Intronic
1070311360 10:75276127-75276149 GACGCAGGAGGGGCAGGGTGTGG + Intergenic
1070533957 10:77361612-77361634 GACTCGGCAGTGGGAGTGGGAGG - Intronic
1070817154 10:79331758-79331780 GACAGAGGAGGGGCAGTGGTGGG + Intergenic
1071562973 10:86657504-86657526 GACACTGGAGGGAGAGTGGGAGG + Intronic
1072553987 10:96500675-96500697 TACTCAGGAGGTTAAGTGGGAGG + Intronic
1074108818 10:110408428-110408450 TACTGAGGAGGGGAAGGGGGAGG - Intergenic
1075002434 10:118808598-118808620 GACTGAGGGGGGTTACTGGGAGG - Intergenic
1075102766 10:119517869-119517891 GACTCAGGAGGGACAGCCGGTGG - Intronic
1075590106 10:123685021-123685043 GTCTCAGGACGGGACGTGGGAGG - Intronic
1076439026 10:130466810-130466832 GACTCAGGAGGGCTGGGGGCAGG - Intergenic
1076674740 10:132142126-132142148 GGCCCAGGAGGGCTAGTGAGGGG - Intronic
1076888834 10:133274379-133274401 GCCTCAGGCAGGGTAGAGGGTGG + Intronic
1080123597 11:28705238-28705260 GAATGAAGAGGGGTAGTGGGTGG + Intergenic
1080350162 11:31375279-31375301 GAATCAGGTGAGGTAGTGGATGG - Intronic
1080588631 11:33702338-33702360 CACTCAGGAGCTGAAGTGGGAGG + Intronic
1081690583 11:45075111-45075133 GGCTCAGGGGGGGCAGCGGGAGG + Intergenic
1081997819 11:47376503-47376525 GACTCAGGAGGGAGAGTGAGGGG - Intronic
1082019931 11:47523759-47523781 GACTCATGAGGGGATGGGGGAGG + Exonic
1082210167 11:49490830-49490852 GACTGAGGAGGGGTTAGGGGAGG - Intergenic
1082801499 11:57418223-57418245 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1083271848 11:61576730-61576752 GACTCAGGAGGGGCAGGAGGGGG + Intronic
1083712953 11:64560004-64560026 GAGGCAGGAGGGGGAGCGGGAGG - Intronic
1083884860 11:65567933-65567955 TACTCAGGAGGCTGAGTGGGAGG - Intergenic
1083889631 11:65589470-65589492 GCCCCAGGAGGGGAATTGGGAGG + Intronic
1083904197 11:65659628-65659650 GACGCAGGAAGGGGAGAGGGTGG - Intronic
1084691302 11:70728461-70728483 GACTCAGGAAGCGTCCTGGGCGG + Intronic
1085283620 11:75346238-75346260 GACTCAGGTGGGGGACTTGGAGG - Intronic
1085343994 11:75754473-75754495 GACTGTGGTGGGGTGGTGGGGGG + Intergenic
1085475035 11:76784023-76784045 ACCTCAGGAGGGGGAGGGGGAGG - Intronic
1086015536 11:82161720-82161742 GACTGCGGTGGGGTAGGGGGAGG + Intergenic
1086634541 11:89065628-89065650 GACCCAGGAGGGCAAGTGGTGGG - Intronic
1086922911 11:92607306-92607328 GACTAAGGAAGGGGGGTGGGGGG + Intronic
1087321129 11:96660224-96660246 GACTCAGCAAGGTTAGTGGGTGG - Intergenic
1088992753 11:114968923-114968945 GACTCAGAAGGGGTAAAGGTGGG + Intergenic
1089735896 11:120550103-120550125 GGGTCAGGAGTGGGAGTGGGAGG + Intronic
1090251107 11:125252562-125252584 GGCTCAGAAGGGGGAGTGGTGGG + Intronic
1090982131 11:131732411-131732433 GACAGAGAAGGGGTAGAGGGTGG - Intronic
1091478277 12:799230-799252 TACTCAGGAGGTGAGGTGGGAGG - Intronic
1091693952 12:2615805-2615827 GTCTCAGCAAGGGTACTGGGGGG + Intronic
1092002438 12:5043795-5043817 GACCCGGGAGGGGAAGCGGGAGG + Intergenic
1092322002 12:7486432-7486454 GACTGAGGAAGGGTAGTGAGGGG - Intronic
1093052286 12:14517253-14517275 TACTCAGGAGGCCTGGTGGGAGG - Intronic
1093143930 12:15541900-15541922 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1093212542 12:16325142-16325164 TACTCGGGCGGGGCAGTGGGGGG + Intergenic
1095688568 12:45063031-45063053 GTCTCAGGGTGGGAAGTGGGAGG - Intergenic
1096239452 12:49951823-49951845 GACTTGAGAGGGGAAGTGGGTGG - Intronic
1096246328 12:49989829-49989851 GTCTCAGGGTGGGAAGTGGGAGG - Exonic
1097043755 12:56172188-56172210 TACTCAGGAGGCTAAGTGGGAGG - Intronic
1097188977 12:57210534-57210556 GCCTGAGGTGGGGTGGTGGGTGG - Intronic
1097308393 12:58093625-58093647 GCCCCAGGAGGGGTAGTGAAAGG + Intergenic
1099492911 12:83307976-83307998 GATTTAGGAGGGGTTGGGGGTGG + Intergenic
1100042386 12:90336108-90336130 AAAACAGGAGGGGTAGAGGGGGG + Intergenic
1100453158 12:94727115-94727137 GAGGCAGGAGGGGCAGAGGGAGG - Intergenic
1100840907 12:98610761-98610783 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1101391330 12:104303202-104303224 TACTCAGGATGGGTATTGGAGGG + Intronic
1101481033 12:105097404-105097426 GACTCAGAAGGGGGAGAGTGGGG - Intergenic
1101876727 12:108600915-108600937 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1102915486 12:116749282-116749304 GTCTCAAAAGGGGTGGTGGGGGG - Intronic
1103309401 12:119992490-119992512 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1104644700 12:130488696-130488718 CCCTCAGGATGGGAAGTGGGAGG - Intronic
1104852156 12:131882075-131882097 AACTCAGGAGGCTAAGTGGGAGG - Intergenic
1104852167 12:131882156-131882178 TACTCAGGAGGCTGAGTGGGAGG - Intergenic
1105532224 13:21230393-21230415 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1106014572 13:25856380-25856402 GACTCAGAAGGGTGAGAGGGTGG + Intronic
1106337621 13:28798050-28798072 TACTCAGGAGGGTGAGTGGGAGG + Intergenic
1106632167 13:31486370-31486392 TACTCAGGAGGCTGAGTGGGAGG - Intergenic
1108266696 13:48717163-48717185 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1108402333 13:50058696-50058718 TACTCAGGAGCTGAAGTGGGAGG + Intergenic
1108691546 13:52863496-52863518 GACTCAGGAGGGCGAGGGAGTGG - Intergenic
1108802629 13:54117975-54117997 GAATCAAGATGGGCAGTGGGAGG + Intergenic
1110063130 13:71066916-71066938 GACTCAGGGGGAATGGTGGGAGG - Intergenic
1111413793 13:87912389-87912411 AATTCAGCAGGGGCAGTGGGAGG + Intergenic
1112946007 13:104927815-104927837 GATTCAGGAGGGGGAAGGGGTGG + Intergenic
1113159579 13:107364934-107364956 AAATGAGGAGGGGGAGTGGGAGG - Intronic
1114801324 14:25779010-25779032 GACTGTGGTGGGGTAGGGGGAGG - Intergenic
1115010998 14:28544553-28544575 GACTGTGGTGGGGTAGGGGGAGG - Intergenic
1115219279 14:31043396-31043418 GACTGAGAGGGGGTAGTGGATGG + Intronic
1115764293 14:36607054-36607076 GACTCTGGTGGGGTTGGGGGTGG - Intergenic
1116090293 14:40295904-40295926 GGCTCTGGTGGGGTAGTGGTGGG + Intergenic
1116674254 14:47885195-47885217 GACTCAGGAGGAAGGGTGGGAGG - Intergenic
1116793627 14:49366130-49366152 GACTCAGGAGTGGTGTCGGGAGG - Intergenic
1117665910 14:58055669-58055691 GATTCAGGAGGTGTAGGGTGGGG - Intronic
1118437397 14:65784253-65784275 GGGGCAGGTGGGGTAGTGGGTGG + Intergenic
1118884362 14:69854014-69854036 CACTCAGCAGGGCCAGTGGGGGG - Intergenic
1119555310 14:75548165-75548187 GGCTCAGCAGGGGTTGTGTGTGG - Intergenic
1119610409 14:76056960-76056982 GAGACAGAATGGGTAGTGGGAGG - Intronic
1119734738 14:76974766-76974788 CACTCAGGTGGGGCAGTGAGAGG - Intergenic
1120521730 14:85533284-85533306 GTGTCAGGAGGGGTAGGGGTGGG + Intronic
1120724620 14:87923837-87923859 GACAGAGGAGGAGGAGTGGGAGG + Intronic
1121469201 14:94138864-94138886 GACTGAGGAAGGGTTGTGGTGGG + Intergenic
1121500607 14:94434006-94434028 GGCTGAGGAGGAGTTGTGGGAGG - Intergenic
1121828380 14:97029086-97029108 GACTCCTGAGGGGAAATGGGAGG + Intergenic
1122081445 14:99270464-99270486 GACGGAGGTGGGGAAGTGGGGGG + Intronic
1122897950 14:104769631-104769653 GACACAGAAGGGGAAGGGGGAGG + Exonic
1123006507 14:105326392-105326414 GCCTCAGGAGGGTGAGTGGCAGG + Intronic
1123062317 14:105599846-105599868 CCCCCAGGAGGGGCAGTGGGAGG - Intergenic
1123087059 14:105721574-105721596 CCCCCAGGAGGGGCAGTGGGAGG - Intergenic
1125413195 15:39426418-39426440 GACTGTGGTGGGGTGGTGGGAGG + Intergenic
1125561185 15:40634874-40634896 AAGTCAGGAGGGGTAGTGATAGG + Intronic
1126019843 15:44389417-44389439 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1127237083 15:57065628-57065650 CACTCAAGGGGGGTGGTGGGGGG - Intronic
1128486193 15:68092279-68092301 TACTCAGGAGGCGAGGTGGGAGG - Intronic
1129251653 15:74312533-74312555 GGCTCAGGAGGGGTGGTGCGGGG - Intronic
1129335133 15:74847533-74847555 GAAGCATGAGGGGTGGTGGGAGG + Intronic
1129908280 15:79205278-79205300 GACTCAGGACAGGGAGAGGGAGG - Intergenic
1130053366 15:80502498-80502520 AACAAAGGAGGGGTAGTAGGTGG + Intronic
1130144023 15:81258589-81258611 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1130984254 15:88834411-88834433 GGCTCAGGAGGGGTGTTGGGAGG - Intronic
1131208443 15:90472164-90472186 TACTCAGGAGGTGAGGTGGGAGG + Intronic
1131779543 15:95841888-95841910 GACTGTGGTGGGGTAGGGGGAGG - Intergenic
1132723099 16:1326495-1326517 GTCGCTGGAGGGGTGGTGGGGGG - Exonic
1135160268 16:20088314-20088336 GAGGCTGGAAGGGTAGTGGGGGG + Intergenic
1135332582 16:21573124-21573146 TACTCAAGAGGGTGAGTGGGAGG + Intergenic
1135493663 16:22932527-22932549 GACTCAGGGAGGGAAGTTGGAGG - Intergenic
1136271845 16:29153320-29153342 AACTCAGGAGGGAAAGCGGGAGG - Intergenic
1137654220 16:50146442-50146464 TACTCAGGAGGTGAGGTGGGAGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1138594135 16:58020589-58020611 GAGACAGGAGGGGTAGAGAGAGG - Exonic
1139363736 16:66419798-66419820 GGTTCAGGAGGGGTAGTGACTGG - Intergenic
1139571476 16:67815606-67815628 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1140003227 16:71047427-71047449 GTCTCAGGTGGGGTTGGGGGTGG + Intronic
1140194357 16:72844558-72844580 GGCTCAGGAGTGGTGGTGGGGGG + Intronic
1140778942 16:78276135-78276157 AACTCATGAGTGGTAGTGAGTGG + Intronic
1142075511 16:88115476-88115498 AACTCAGGAGGGAAAGCGGGAGG - Intronic
1143126268 17:4642652-4642674 CACTCTGGTGGGGTGGTGGGGGG - Intergenic
1144084563 17:11797359-11797381 GACTGAGGATGGGAAGTGGGAGG - Intronic
1144710701 17:17399683-17399705 CACTCACGGGGGCTAGTGGGAGG - Intergenic
1145750707 17:27353600-27353622 AACTCAGGCGGGGTCGTGTGGGG - Intergenic
1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG + Intergenic
1145915734 17:28573015-28573037 GACTCTGGAGGTGGAGAGGGTGG - Intronic
1146005085 17:29155849-29155871 GGCTCAGGAGAGGGAGTGGGAGG - Intronic
1146652138 17:34613517-34613539 GAGTCAGGGGAGGCAGTGGGGGG - Intronic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1146910067 17:36642613-36642635 AACTGAGGAGGGGCAGAGGGTGG - Intergenic
1147035534 17:37677118-37677140 GAGTCAGGCATGGTAGTGGGTGG - Intergenic
1147162064 17:38574107-38574129 GGCGGAGGAGGGGTAGTGGCAGG - Intronic
1147178106 17:38669314-38669336 GGCTCAGGAGGGGTGCTGGAGGG + Intergenic
1147239820 17:39083399-39083421 GACTGTGGAGGGGAAGAGGGTGG - Intronic
1149560885 17:57607248-57607270 GACTCAGGAGGGTTACTCTGGGG - Intronic
1150845890 17:68657638-68657660 TACTCATGGGGGGCAGTGGGTGG - Intergenic
1151167051 17:72213088-72213110 AAGCCAGGAAGGGTAGTGGGTGG - Intergenic
1151871111 17:76837492-76837514 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1152210434 17:79000422-79000444 GAGGCAGGAGGGGTGGAGGGAGG - Intronic
1152239019 17:79152029-79152051 GAAGCAGGAGGGGTGATGGGAGG + Intronic
1152268332 17:79309315-79309337 GGCTCAGGAGAGGTGGAGGGAGG - Intronic
1152368322 17:79870227-79870249 GAAAAAGGAGGGGAAGTGGGAGG - Intergenic
1152440812 17:80308422-80308444 GACTCAGGAGGAGCCTTGGGAGG - Intronic
1152440826 17:80308480-80308502 GACTCAGGAGGGGACTTAGGAGG - Intronic
1152710213 17:81867599-81867621 GACCCTGGTGGGGTGGTGGGAGG - Intergenic
1153269322 18:3304053-3304075 GACTCAGAAGGGGAAGTAGGAGG + Intergenic
1153727558 18:7972303-7972325 GACTGTGGTGGGGTAGGGGGAGG + Intronic
1154526909 18:15300344-15300366 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1155738775 18:29259351-29259373 GACTTTAGAGGGGTAGTGGGAGG + Intergenic
1155766256 18:29637071-29637093 TACTCAGGAGGCTGAGTGGGAGG - Intergenic
1156021558 18:32605807-32605829 GACTCTGGTGGGGTCGGGGGAGG - Intergenic
1157626292 18:49053936-49053958 GACCCAGGATGGGAGGTGGGTGG + Intronic
1158280673 18:55822160-55822182 TACTCAGGGGGAGTAGGGGGAGG + Intergenic
1158966602 18:62627662-62627684 TACTCAGGAGGGGAAGGAGGAGG - Intergenic
1159681644 18:71360656-71360678 GGCTGAGAAAGGGTAGTGGGCGG + Intergenic
1159684057 18:71394539-71394561 GACTCAGGAGGGTGAGGTGGTGG - Intergenic
1161847270 19:6718969-6718991 GATTCAGAAGGGGTGGGGGGGGG + Intronic
1161903847 19:7140192-7140214 GTCCCAGGAGGGGTAGAGGGAGG + Intronic
1162027278 19:7901480-7901502 GACTCAGGAGGTTTGGTTGGGGG + Exonic
1162108865 19:8389421-8389443 GACAAAAGAGGGGTAGTGGTAGG + Intronic
1162860241 19:13501038-13501060 GACTCAAGAGGGGCACTGTGGGG + Intronic
1162937058 19:13986553-13986575 AAGCCAGGAGGGGAAGTGGGGGG + Intronic
1163467254 19:17475424-17475446 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1165031333 19:32999976-32999998 TACTCAGGAGGTGAGGTGGGAGG - Intronic
1165135469 19:33665753-33665775 GACTCCTGATGGGTAGAGGGTGG + Intronic
1165435555 19:35792913-35792935 GAATAAGGAGGGTTACTGGGGGG + Intergenic
1165550229 19:36577587-36577609 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1165636691 19:37346402-37346424 GCCTAAGGAGGGAAAGTGGGTGG - Intronic
1165910540 19:39223672-39223694 TACTCAGGAGGCTGAGTGGGGGG + Intergenic
1166387515 19:42390439-42390461 GAGGCAGGAGGAGAAGTGGGGGG - Intergenic
1166839383 19:45687402-45687424 GATTCAGGAGGGCTTGGGGGAGG - Intergenic
1166870579 19:45867962-45867984 GACTCGGGAGGGGTCGAGGGTGG + Intronic
1167763186 19:51462128-51462150 GACTCAGGAGGGGCTGGCGGAGG + Intergenic
1167806821 19:51792756-51792778 TACTCAGGAGGTGAAGTGGGAGG - Intronic
1168376209 19:55882008-55882030 GGCTCAGGAGGGTGAGAGGGAGG - Intergenic
1168421079 19:56204159-56204181 AACTCTGGAGGGATAGAGGGAGG - Intronic
1168424365 19:56226761-56226783 AACTCTGGAGGGATAGAGGGAGG + Intronic
1168426307 19:56241982-56242004 AACTCTGGAGGGATAGAGGGAGG - Intronic
926128458 2:10285979-10286001 GGCTGAGGAGGGGTACTGGGAGG + Intergenic
929437670 2:41940708-41940730 GACTTAGCTGGGGCAGTGGGGGG - Intronic
929950539 2:46406536-46406558 GACCCAGGAGGGGCATTGTGAGG - Intergenic
930087726 2:47509828-47509850 GCCTCAGGTTGGGGAGTGGGGGG - Intronic
931251054 2:60530821-60530843 GACTCAGGAGGGGTAGTGGGAGG - Intronic
931609807 2:64086844-64086866 AGCTGCGGAGGGGTAGTGGGAGG - Intergenic
933829110 2:86192122-86192144 TACTCAGGAGGTGAGGTGGGAGG + Intronic
934545913 2:95216025-95216047 GAGTCAGGAGTGGTGGTGGAAGG + Intronic
934738545 2:96702804-96702826 GCCTCTGGAGGGGTGGGGGGAGG - Intergenic
934900826 2:98158672-98158694 GACTGAGAAGGGGGAGTAGGAGG + Intronic
935131070 2:100261295-100261317 GACTCAGGAGGGGGAAATGGGGG + Intergenic
935622312 2:105141004-105141026 GACTGTGGTGGGGTAGGGGGAGG + Intergenic
936970875 2:118175214-118175236 GACCCGGGAGGGGTGCTGGGTGG + Intergenic
937952818 2:127401457-127401479 GCCACAGAAGGGGTAGCGGGAGG + Intergenic
938300294 2:130206140-130206162 TACTCAGGAGGCTTAGTGGGAGG + Intergenic
938456431 2:131468355-131468377 TACTCAGGAGGCTTAGTGGGAGG - Intronic
938663210 2:133508089-133508111 GAGTCAGGAGGGGTGGTCAGAGG + Intronic
938824547 2:134991976-134991998 GACTCAGGTGGTATATTGGGTGG + Intronic
940285270 2:152027481-152027503 GAGTCAGGAGGGGAGGTGGCAGG - Intronic
940518567 2:154713471-154713493 GCCTCAGCAGGAGTGGTGGGGGG + Intronic
942628049 2:177924878-177924900 GACTGTGGTGGGGTAGGGGGAGG - Intronic
943127757 2:183816843-183816865 GACTCAGGAAGAAGAGTGGGAGG - Intergenic
944077846 2:195752160-195752182 TACTCAGGAGGCTGAGTGGGAGG + Intronic
944452545 2:199857554-199857576 TACTCGGGAGGTGAAGTGGGAGG + Intergenic
945109681 2:206350363-206350385 GAAAATGGAGGGGTAGTGGGAGG - Intergenic
946159886 2:217829662-217829684 GACTCAGGAGGTGTCCAGGGTGG + Intronic
946329177 2:219000195-219000217 GTCTTAGGATGGATAGTGGGTGG + Intergenic
947132955 2:226948409-226948431 GACTGTGGTGGGGTAGGGGGAGG + Intronic
947650695 2:231784116-231784138 GACTGAGAAGGGGGAGGGGGTGG + Intronic
948003595 2:234589419-234589441 GACTGAGGAGCGGGAATGGGGGG - Intergenic
948045444 2:234940233-234940255 GACGTAGGAGGGCTGGTGGGAGG + Intergenic
948079038 2:235190413-235190435 GACTCACCAGAGGTGGTGGGAGG + Intergenic
948350458 2:237335950-237335972 GGCACAGGATGGGGAGTGGGAGG + Intronic
948454606 2:238098999-238099021 GAAGCAGGAGGGGTGGTGGGCGG - Exonic
948965974 2:241380849-241380871 GAATCAGGAGGAGGAGTGGGTGG + Intronic
1168801171 20:644152-644174 TACTCAGGAGGCTAAGTGGGAGG + Intergenic
1170457746 20:16549189-16549211 GACTGTGGTGGGGTAGGGGGAGG - Intronic
1172083123 20:32358305-32358327 GAGTGAGGAGGGGGAGTGTGGGG - Intergenic
1172090131 20:32424943-32424965 GACTGGGAAGGGGCAGTGGGGGG - Intronic
1172223250 20:33287887-33287909 GACTCTGGAGGGGCATGGGGGGG - Intronic
1172302369 20:33859130-33859152 GGCTCAGGAGGGTTTGTGGGAGG + Intergenic
1174353288 20:49982927-49982949 TACTCCGGGGGGGTGGTGGGGGG - Intergenic
1174641635 20:52049658-52049680 GAAAAAGGAGTGGTAGTGGGAGG - Intergenic
1175295313 20:57904282-57904304 GGCTCAGGAGGAGGAGGGGGAGG - Intergenic
1176048795 20:63105825-63105847 GAGTCAGGAGGGGATGTGGCAGG + Intergenic
1176139396 20:63538357-63538379 GACACAGTAGGGTCAGTGGGAGG - Intergenic
1176149004 20:63579409-63579431 GCCTCAGCAGGAGTAGAGGGTGG + Intergenic
1176194970 20:63832511-63832533 CATTCAGGAGCGGCAGTGGGAGG + Intergenic
1176383377 21:6124980-6125002 GAGACAGAAGGGGGAGTGGGGGG + Intergenic
1178297893 21:31426172-31426194 GACTCAGGAGGAAGGGTGGGAGG - Intronic
1179412249 21:41170900-41170922 GACCCCCGAGGGGTGGTGGGTGG - Intronic
1179435954 21:41362266-41362288 GGCTCTGGAGGGGAAGTGGCTGG + Intronic
1179527742 21:41994702-41994724 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1179740091 21:43413259-43413281 GAGACAGAAGGGGGAGTGGGGGG - Intergenic
1179997333 21:44980117-44980139 GAGACAGGAGAGGCAGTGGGAGG + Intergenic
1180517618 22:16162254-16162276 GACTCAGAAGGGTGAGAGGGTGG + Intergenic
1180557461 22:16589512-16589534 TACTCAGGAGGCTGAGTGGGGGG - Intergenic
1180710903 22:17838880-17838902 GACACAGGACGGGAAGTGCGTGG - Intronic
1180947171 22:19702518-19702540 GACTCAGGAGGGGAGGAGAGTGG + Intergenic
1180970404 22:19812047-19812069 GAATCAGGAGGCGTTGGGGGAGG - Intronic
1181028495 22:20138867-20138889 GACTGGGGCGGGGTAGGGGGCGG - Intronic
1181292113 22:21803867-21803889 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1181877711 22:25953036-25953058 GAATCAGGAGGGCTTCTGGGAGG + Intronic
1181913576 22:26260287-26260309 GACTCAGGGGAAATAGTGGGAGG - Intronic
1182001895 22:26926578-26926600 GAGTAAGGAGGGGTGGTGGTGGG + Intergenic
1182299509 22:29329835-29329857 GACCCAGGAGGGGCAGTGTCTGG + Intronic
1182320254 22:29474176-29474198 GAGTCAGTATGGATAGTGGGAGG + Intergenic
1182613537 22:31569837-31569859 TACTCAGGAGGCTAAGTGGGAGG + Intronic
1183313124 22:37122300-37122322 GACGCAGGTCGGGTAGTGGAGGG - Intergenic
1183321402 22:37167205-37167227 GATACAGGAGGGGCAGAGGGTGG - Intronic
1183438589 22:37809709-37809731 TACTCAGGAGGTTAAGTGGGAGG + Intronic
1184089084 22:42283212-42283234 GACAAAGGAGGGGCAGTGGGTGG - Intronic
1184149667 22:42630841-42630863 GACTGTGGAGGGGGTGTGGGTGG - Intronic
1184308849 22:43628187-43628209 GACTTAGGAGGAGTAGGGTGGGG - Intronic
1185277263 22:49955177-49955199 GACTCAGGAGAGGTGGTGGTGGG - Intergenic
949539446 3:5020652-5020674 GACTGAGGTGGGGCAGTGGCAGG - Intergenic
949592378 3:5507954-5507976 GACTCAGGAAGGGAAGAGGATGG + Intergenic
949909843 3:8893803-8893825 TACTCAGGAGATGTGGTGGGAGG - Intronic
949937419 3:9126763-9126785 GACTCAGAAGGGTGAGGGGGTGG + Intronic
950012822 3:9735119-9735141 TACTCAGGAGGCTGAGTGGGAGG - Intronic
951547470 3:23842353-23842375 TACTCAGGAGGCGAGGTGGGAGG - Intronic
952447809 3:33399667-33399689 GACTCCGAAGGGGTAGCAGGAGG + Intronic
954019910 3:47730370-47730392 TACTCAGGAGGTGAGGTGGGAGG + Intronic
954387368 3:50251208-50251230 GACTCAGAAGGGCAAGAGGGTGG - Intronic
954417773 3:50402351-50402373 GACTCAGGAGGACGTGTGGGTGG + Intronic
954958980 3:54548088-54548110 GACTGAGGAGGGGAACTGGGAGG + Intronic
955561485 3:60195867-60195889 GACTCAGAAGGGAGGGTGGGAGG + Intronic
955684918 3:61539912-61539934 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
956425268 3:69127969-69127991 GAGTGGGGAGGGGAAGTGGGCGG + Intergenic
956710131 3:72031765-72031787 GACTCAGGAGGACTGGTTGGTGG + Intergenic
956800474 3:72753475-72753497 GAGGCAGCAGGGGTTGTGGGGGG - Intronic
956988156 3:74728785-74728807 GACTGAGGAGGGGTAGAAGTGGG - Intergenic
957802798 3:85106763-85106785 GAATAGGGAGGGGTAGAGGGAGG + Intronic
957825125 3:85431724-85431746 GAGTCAGAAGGGGTTGTAGGTGG + Intronic
958847554 3:99283084-99283106 GAGGCGGGAGGGGTAGTCGGGGG + Intergenic
960022778 3:112974325-112974347 CACTCAGGAGGCTGAGTGGGAGG + Intronic
960056696 3:113280937-113280959 GACTCAGCTGGGGCAGTGTGTGG - Intronic
960873544 3:122274780-122274802 GATTCAGGAGGTGCAGTGGAAGG + Intronic
961040720 3:123676166-123676188 GAGTTGGGAGGAGTAGTGGGTGG + Intronic
961319745 3:126064399-126064421 GAGTCAGCAGGGGATGTGGGGGG - Intronic
961351460 3:126307237-126307259 GACCCAGGAAGGGTGCTGGGTGG - Intergenic
961496856 3:127299463-127299485 GACTCAGGAGGGTGAGTGCTGGG - Intergenic
961532366 3:127547470-127547492 TACTCAGGAGGGGTCAAGGGAGG + Intergenic
961963816 3:130881367-130881389 GACAAAGGAGGGGAAGGGGGAGG - Intronic
962949514 3:140204996-140205018 GAATCAGGAGGGGTGAGGGGAGG + Intronic
963236289 3:142960517-142960539 GGCTCAGCAGGAGGAGTGGGTGG - Intronic
963833100 3:150029818-150029840 GACTGAGAAGGAGTAGTTGGAGG + Intronic
965460977 3:168962896-168962918 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
966389177 3:179433494-179433516 CACTCAGGAGGCTGAGTGGGGGG + Intronic
967266999 3:187699852-187699874 GTCTCAGGAAGTGTTGTGGGTGG + Intronic
967779497 3:193419843-193419865 GGCCCTGGAGGGGCAGTGGGTGG - Intronic
968107715 3:196014182-196014204 GACTCAGGTGTTGTGGTGGGCGG + Intergenic
968799254 4:2731559-2731581 GACTCGGGAGGAGGAATGGGTGG - Intronic
969538530 4:7771273-7771295 GACTCAGGAAGTGAGGTGGGAGG + Intronic
970523502 4:16908927-16908949 AACTCAGCAGGGGTGGTGTGAGG - Intergenic
971246872 4:24937223-24937245 AACTCAGGAGGGGTGGAAGGAGG + Intronic
972306241 4:37832874-37832896 GACTCAGTGGGGGAAGAGGGAGG - Intronic
973196022 4:47443007-47443029 GAGTCAGGAGTGGGGGTGGGTGG - Intergenic
973584363 4:52375921-52375943 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
974081767 4:57221344-57221366 GACTGAGGTGGGGTCGGGGGAGG - Intergenic
976352718 4:84078349-84078371 GACTGTGGTGGGGTAGGGGGAGG + Intergenic
976503021 4:85814223-85814245 GATTTGGGAGGGGTAATGGGTGG - Intronic
976879529 4:89902168-89902190 GACTGTGGTGGGGTAGGGGGAGG + Intronic
977879073 4:102183830-102183852 GACTCAGGGGGAAGAGTGGGAGG + Intergenic
978994058 4:115128111-115128133 GACTCAGAAGGGTTAGGGGGCGG - Intergenic
980561233 4:134479173-134479195 TACTCAGGAGGCCAAGTGGGAGG - Intergenic
982765028 4:159336323-159336345 GACTCAGAAGGGGAAGGGTGAGG - Intronic
982779901 4:159479986-159480008 TACTCAGGAGGTGAGGTGGGAGG - Intergenic
983886165 4:172982973-172982995 GACTCAGAAGGGTGAATGGGTGG + Intronic
984632356 4:182074302-182074324 GTCCCAGGCAGGGTAGTGGGAGG + Intergenic
985198398 4:187458594-187458616 GACTCAGGAAGTGAGGTGGGAGG - Intergenic
985287160 4:188347815-188347837 GAGTCTGGAAGGGTAGTGGTGGG + Intergenic
985586450 5:740118-740140 GACTCAGGGGGAGTGGTGGGAGG + Intronic
985601038 5:832295-832317 GACTCAGGGGGAGTGGTGGGAGG + Intronic
985976005 5:3419599-3419621 GACTCAGGAGCGGGGGTGAGGGG + Intergenic
986188843 5:5474337-5474359 GACTCTGGAGGGGCGGAGGGTGG + Intronic
987698862 5:21368362-21368384 GACTGTGGTGGGGTAGAGGGAGG + Intergenic
988066777 5:26235244-26235266 GACTCAGGTGTGGTGGTGGGCGG + Intergenic
988066846 5:26235516-26235538 GACTCAGGTGTGGTGGTGGGCGG + Intergenic
988066864 5:26235576-26235598 GACTCGGGTGTGGTGGTGGGCGG + Intergenic
988067035 5:26236231-26236253 GACTTAGGTGTGGTGGTGGGCGG + Intergenic
988067053 5:26236291-26236313 GACTCGGGTGTGGTGGTGGGCGG + Intergenic
988067113 5:26236503-26236525 GACTCGGGTGTGGTGGTGGGCGG + Intergenic
988067161 5:26236683-26236705 GACTCAGGTGTGGTGGTGGGCGG + Intergenic
988067173 5:26236727-26236749 GACTCAGGTGTGGTGGTGGGCGG + Intergenic
989628613 5:43458005-43458027 TACTCAGGAGGTGAGGTGGGAGG - Intronic
990451912 5:55941649-55941671 GACACAGCAGTGGTATTGGGGGG - Exonic
990836715 5:60029717-60029739 GACTCAGAAGGGTAAGAGGGTGG - Intronic
991010869 5:61881859-61881881 GACCCAGGAGGGGTAGTACCTGG - Intergenic
991424466 5:66476480-66476502 TGCTCAGGAGTGGTAGGGGGCGG - Intergenic
991690582 5:69221211-69221233 CAGGCAGGAGGGGTAGTGTGTGG + Intronic
992554007 5:77885610-77885632 GACCTAGGAGGGGAATTGGGAGG - Intergenic
993958910 5:94272181-94272203 GAGTTGGGAAGGGTAGTGGGGGG + Intronic
994086627 5:95766359-95766381 GATTCAGCAGGGGGAATGGGTGG + Intronic
994921136 5:106045759-106045781 TACTCAGGAGGCTAAGTGGGAGG - Intergenic
997540427 5:134657074-134657096 TACTCAAGAGGGGAGGTGGGAGG + Intronic
997927633 5:138045422-138045444 TACTCAGGAGGCTGAGTGGGAGG + Intronic
999745786 5:154590754-154590776 GACAAAGGAGGGGGAGGGGGAGG - Intergenic
1000371438 5:160540285-160540307 TAGCAAGGAGGGGTAGTGGGTGG + Intergenic
1001776279 5:174331398-174331420 GAGTCAGGAGGGGGCCTGGGAGG + Intergenic
1003276734 6:4660426-4660448 GAATATGGAGGGGTGGTGGGTGG - Intergenic
1004160808 6:13211269-13211291 GACTCAGGGGGAGGGGTGGGAGG - Intronic
1005715897 6:28548038-28548060 GACTCAGGAGGTGTGGGGGGAGG + Intergenic
1006038942 6:31237420-31237442 TACTCAGGAGGCTGAGTGGGAGG - Intergenic
1006404888 6:33839172-33839194 AACACAGGAGGGGCAGTGGAAGG - Intergenic
1007471672 6:42094730-42094752 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1007498031 6:42274973-42274995 GTCCCAGAAGGGGTACTGGGTGG - Intronic
1007729784 6:43938904-43938926 CACACAGGAGGGGAAGTGGCGGG - Intergenic
1008505145 6:52222968-52222990 GAATGATGAGGGGTTGTGGGTGG - Intergenic
1008800539 6:55363586-55363608 GACTGAGGTGGGGTGGGGGGAGG - Intronic
1008937971 6:57013030-57013052 GACCCAGGATGGGGAATGGGAGG - Intronic
1009271371 6:61619257-61619279 GACTCAGAAGGGGGAGGGTGGGG - Intergenic
1010273930 6:73948027-73948049 GCCTCAGTAGGTGTAGTGGTGGG + Intergenic
1010841954 6:80657122-80657144 GACTCAGGAGGGAAAGGGGAGGG + Intergenic
1011989656 6:93498469-93498491 GAAACAGAAGGGGTAGTGGAGGG - Intergenic
1013930786 6:115529902-115529924 GACTCAGGGGGAAGAGTGGGAGG - Intergenic
1014489528 6:122044942-122044964 GAAAAAGGAGGGGTTGTGGGTGG + Intergenic
1014660527 6:124165665-124165687 GACTGTGGTGGGGTAGGGGGAGG - Intronic
1016687015 6:146893039-146893061 GACTCAGGAGGCAGAGGGGGTGG + Intergenic
1019697967 7:2458224-2458246 GACTCAGGGTGGGTGGAGGGAGG - Intergenic
1021377676 7:19928444-19928466 GACTCAGTAGTGGTAGTAGGAGG - Intergenic
1022425344 7:30263462-30263484 GACCCAGGAGTGGTAGGGGAGGG - Intergenic
1022573135 7:31472653-31472675 GACTTGGGAGGGTTAGGGGGTGG + Intergenic
1022654508 7:32306480-32306502 GACTAAGGTGGGGTCGTGTGTGG - Intergenic
1023036524 7:36135944-36135966 TCCTCAGGAGAGGCAGTGGGTGG + Intergenic
1023231442 7:38034269-38034291 GACTTAGGAGTGGGAGTTGGAGG + Intergenic
1024530939 7:50392279-50392301 GACTCTGAAGGGTTAATGGGAGG + Intronic
1024884712 7:54127347-54127369 AACTCAGAATGGGGAGTGGGAGG - Intergenic
1025029877 7:55548400-55548422 GAGTCCGGAGGGGCAGAGGGCGG - Intronic
1026219167 7:68377276-68377298 TACTCAGGAGGCTGAGTGGGAGG + Intergenic
1026452706 7:70543378-70543400 TACTCGGGAGGGGTGGTGGCGGG + Intronic
1028710451 7:93901824-93901846 TACTCAGGAGGTGAGGTGGGAGG + Intronic
1029688330 7:102164179-102164201 GGCCCCGGAGGGGTGGTGGGCGG - Intronic
1030877750 7:114836380-114836402 GAATCAGGAGGGAGAGAGGGAGG - Intergenic
1032012600 7:128356688-128356710 GGCTGGGGAGGGGTTGTGGGAGG + Intronic
1032081377 7:128860136-128860158 GATCCAGGAGGGGTAGGGAGGGG - Intergenic
1032728379 7:134613456-134613478 GACTGGGATGGGGTAGTGGGTGG - Intergenic
1034506179 7:151493223-151493245 GCCTCAGGATGGGTTGTCGGGGG - Intronic
1034590173 7:152131857-152131879 GAGTGAGGGAGGGTAGTGGGAGG + Intergenic
1035010744 7:155713406-155713428 GACACAGGAGGGGGAGGGGCAGG + Intronic
1035203120 7:157279297-157279319 GACGCGGGAGGGGGCGTGGGAGG + Intergenic
1035281955 7:157784258-157784280 GTCTCAGGAGGCCAAGTGGGGGG + Intronic
1035663500 8:1364114-1364136 GGCTCAGGAGGGAAGGTGGGTGG - Intergenic
1035997306 8:4562302-4562324 GACTCAGCAAGGTCAGTGGGAGG + Intronic
1036638008 8:10564711-10564733 GAGGCAGGAGGGGAAGAGGGTGG + Intergenic
1038227473 8:25670446-25670468 ACCCCTGGAGGGGTAGTGGGAGG + Intergenic
1039574511 8:38612644-38612666 GACTGAGTTGGGGTGGTGGGAGG - Intergenic
1043489695 8:80736686-80736708 GACTCAGGGGAAATAGTGGGAGG + Intronic
1043851908 8:85225508-85225530 TACTCAGGAGGAGGGGTGGGAGG - Intronic
1045489459 8:102657352-102657374 GACTCAGGAGGGGCGGTGACAGG - Intergenic
1046483724 8:114857570-114857592 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1046925409 8:119781599-119781621 GACTCAGGACGGGGAGGGGGAGG + Intronic
1047008237 8:120643421-120643443 GACTCAGGAGGAAGGGTGGGAGG - Intronic
1047265167 8:123300560-123300582 TACTCAGCAGAGGTAGTAGGTGG - Intergenic
1048341993 8:133547376-133547398 TACTCAGGAGGCTTAGAGGGAGG - Intronic
1048899540 8:139024302-139024324 GACTCAGGAGGGGAAGCGATGGG + Intergenic
1051381908 9:16467674-16467696 GACTGTGGTGGGGTCGTGGGAGG + Intronic
1051494275 9:17701370-17701392 GCTTCAGGAGGAGTAGTGAGGGG + Intronic
1051904033 9:22074713-22074735 TGCCCAGGAGAGGTAGTGGGTGG - Intergenic
1052922817 9:33985910-33985932 TACTCAGGAGGGTAAGTAGGAGG + Intronic
1053103706 9:35392634-35392656 GACTGTGGTGGGGTAGGGGGAGG + Intronic
1053704695 9:40739049-40739071 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1054414775 9:64862656-64862678 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1055731342 9:79282037-79282059 GACTCAGCAGGGGTTGTTGGGGG - Intergenic
1056031340 9:82556673-82556695 GACTAAGGAGGAGCAGTGTGTGG + Intergenic
1056317313 9:85402468-85402490 GACTCAGGAGGGGAAATGGGTGG - Intergenic
1056766549 9:89447743-89447765 GAGTCAGGAAGGGTAGGGGTAGG - Intronic
1056802052 9:89699068-89699090 GACTCAGGAGGGGTATAGACCGG + Intergenic
1057016407 9:91656530-91656552 GACTCCGGTGGGGTGGTGAGGGG + Intronic
1057205412 9:93169158-93169180 GGCTGTGGAGGGGTCGTGGGAGG - Intergenic
1057267927 9:93631083-93631105 GAATCAGTAGGGGCAGAGGGAGG + Intronic
1057313871 9:93956989-93957011 GACTCGGGAGTGGGGGTGGGGGG + Intergenic
1057707973 9:97411811-97411833 GACTCAGCAGGGGGCGAGGGTGG - Intergenic
1057726360 9:97571287-97571309 GACTCTGGGGGGATAGTGTGTGG - Intronic
1057868610 9:98701274-98701296 GACTGAGTTGGGGTGGTGGGTGG - Intronic
1058017230 9:100048130-100048152 TACTCAGGAGGCTGAGTGGGAGG + Intronic
1058330151 9:103750478-103750500 GACTGTTGAGGGGTAGGGGGAGG - Intergenic
1058978562 9:110147661-110147683 TACTCAGGAGGCGAGGTGGGAGG + Intronic
1059197758 9:112386672-112386694 TATTCAGGAGGCTTAGTGGGAGG + Intronic
1059259772 9:112964313-112964335 GAGTTAGGAGTGGCAGTGGGAGG - Intergenic
1059433495 9:114263539-114263561 GACACACGTGGGGCAGTGGGTGG + Intronic
1059824286 9:118009721-118009743 AACTCAGGAATGGTAGTGGAGGG - Intergenic
1060291081 9:122303487-122303509 TACTCAGGAGGCTGAGTGGGAGG - Intronic
1060825557 9:126685721-126685743 GACTCAGCAAGGGTAGTAAGCGG + Intronic
1060946926 9:127575132-127575154 GAATGGGGAGGGGAAGTGGGGGG - Intronic
1061208391 9:129177195-129177217 GCCACAGCAGGGGCAGTGGGCGG + Exonic
1061334627 9:129923974-129923996 GAGGCAGGAGGGGGAGGGGGAGG + Exonic
1062061953 9:134501719-134501741 GACTCAGCAGGGGTGAGGGGCGG - Intergenic
1062165594 9:135105809-135105831 GACCCTGGATGGGAAGTGGGTGG - Intronic
1062332695 9:136051505-136051527 GACTCCGGAGGGGGCGGGGGCGG + Intronic
1062337719 9:136079737-136079759 GTCGCAGAATGGGTAGTGGGAGG - Intronic
1187104825 X:16230825-16230847 GACTGTTGTGGGGTAGTGGGAGG - Intergenic
1188621277 X:32227549-32227571 GACTCAGAAGGGCGAGAGGGTGG + Intronic
1190037241 X:47036951-47036973 GACTGTGGTGGGGTAGGGGGAGG + Intronic
1191098708 X:56701745-56701767 GACTGTGGAGGGGTCGGGGGAGG + Intergenic
1191270997 X:58468998-58469020 GACTGTGGAGGGGTCGGGGGAGG + Intergenic
1192982142 X:76355926-76355948 GACTCAGGAGAAAGAGTGGGGGG + Intergenic
1193302578 X:79908067-79908089 GACTCAGAAGGGTGAGAGGGTGG - Intergenic
1193460313 X:81783793-81783815 GACTCAGAAGGGGGAGGGTGGGG - Intergenic
1194075951 X:89394273-89394295 GACTCAGGGGGGAAGGTGGGAGG - Intergenic
1194152998 X:90349529-90349551 TACTCAGGAGTTGAAGTGGGAGG - Intergenic
1197861796 X:130979098-130979120 GACTCAGAAGGGGGAGAGTGGGG - Intergenic
1198633895 X:138673979-138674001 GCCTTAGGAGGGGGAGAGGGAGG + Intronic
1199643023 X:149881731-149881753 GACTCAAGAGGAGCAGAGGGAGG + Intronic
1199669521 X:150131557-150131579 GACTGTGGAGGGGTGGGGGGAGG - Intergenic
1199851885 X:151729669-151729691 GGCTTAGGAGGGACAGTGGGGGG - Intergenic
1199982215 X:152927455-152927477 GTCCCAGGAGGGGTAGGGGATGG - Intronic
1200096355 X:153665956-153665978 GACTCAATGGGGGTGGTGGGGGG - Intergenic
1200499343 Y:3926331-3926353 TACTCAGGAGTTGAAGTGGGAGG - Intergenic
1201066421 Y:10099952-10099974 GACTCAGGAGGGTGAGGGGATGG - Intergenic
1201766716 Y:17579635-17579657 GACTCAGGAGTGGTTGTCCGAGG - Intergenic
1201771594 Y:17621531-17621553 TACTCAGGAGAGGGGGTGGGGGG + Intergenic
1201829961 Y:18284455-18284477 TACTCAGGAGAGGGGGTGGGGGG - Intergenic
1201834837 Y:18326350-18326372 GACTCAGGAGTGGTTGTCCGAGG + Intergenic