ID: 931252655

View in Genome Browser
Species Human (GRCh38)
Location 2:60547760-60547782
Sequence CTCAATATTCAGCCTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931252655_931252664 12 Left 931252655 2:60547760-60547782 CCCTACCCAGGCTGAATATTGAG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 931252664 2:60547795-60547817 GAGTAACTCCCAGATGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 110
931252655_931252663 -10 Left 931252655 2:60547760-60547782 CCCTACCCAGGCTGAATATTGAG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 931252663 2:60547773-60547795 GAATATTGAGGGGGAAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931252655 Original CRISPR CTCAATATTCAGCCTGGGTA GGG (reversed) Intronic
902487022 1:16755032-16755054 CTCAATATGCAGTCTGGCTGTGG + Intronic
904550149 1:31309600-31309622 CTCAAAACTCAGGCTGGGTATGG - Intronic
907713228 1:56903878-56903900 CTCAATGTACAGCCTGGGTTGGG + Intronic
908746966 1:67385196-67385218 CTCATAATTCAGCATGGCTAGGG + Intronic
909674636 1:78225538-78225560 CTCAATAACCAGCATGTGTAAGG - Intergenic
913241549 1:116834592-116834614 CTCAGTATTGAGCCTAGGGAAGG - Intergenic
913297428 1:117335488-117335510 TTCAGTATTCAGGCTGGGCATGG - Intergenic
914242482 1:145860990-145861012 TTCAATCTTTGGCCTGGGTAGGG - Intergenic
914886155 1:151586002-151586024 CTTTATCTTCAGCCTGGGTATGG - Intergenic
917742487 1:177974517-177974539 CTCAATATTCCTCCTAGGTTTGG - Intronic
917792898 1:178511077-178511099 ATCATTATTCAGACTGGGCATGG + Intergenic
918833227 1:189425486-189425508 CTTAATATTAAGACTGGGAATGG - Intergenic
919256109 1:195127649-195127671 CTCAAATTTCAGCATGGCTAGGG + Intergenic
920267478 1:204734812-204734834 GACAATAATCAGCCTGGGTCAGG - Intergenic
921303432 1:213772207-213772229 CCCATTATGCAGCGTGGGTAAGG + Intergenic
1064517178 10:16164024-16164046 CTCAATATTCATAAGGGGTATGG + Intergenic
1065999488 10:31091140-31091162 CTTAATAATCAGCCTGAGTCAGG - Intergenic
1067732417 10:48821514-48821536 CTCAGCATTCTGCCTGGGTACGG + Intronic
1067781357 10:49209598-49209620 TTCATTCTTCAGCCTGGGCAAGG + Intergenic
1068275045 10:54783924-54783946 CTCAGAGTTCAGCCTGGCTAGGG + Intronic
1074312606 10:112335279-112335301 CTCAATATTGAGTCAGGTTATGG - Intergenic
1078691985 11:13590941-13590963 TTCAATATCCAGGCTGGGCACGG + Intergenic
1079328940 11:19518248-19518270 CTCAACATTTAGCATGGGTCTGG - Intronic
1080213908 11:29819257-29819279 CTAAATATTCAACCTGGTTGAGG + Intergenic
1084428525 11:69098618-69098640 CTTAAAGTTCAGCCTGGGAATGG - Intergenic
1086806446 11:91249191-91249213 CTCAAAATGCAGCCTTTGTATGG + Intergenic
1087229903 11:95649046-95649068 CTCAATTTTCAGCATTGTTATGG + Intergenic
1089719740 11:120404228-120404250 CTCAATATTCAGCATGTGGTAGG + Intronic
1089858785 11:121570647-121570669 TTCAATATTCAGCCTTTTTAGGG + Intronic
1091867940 12:3858797-3858819 ATGAATATTCAGGCTGGGTGCGG + Intronic
1091967514 12:4757143-4757165 CTCACAATTCAGCATGGCTAGGG - Intronic
1096813580 12:54187204-54187226 CTCAACTTTCTGCCTGGGTCAGG + Intronic
1097476245 12:60058981-60059003 TACAATGTTCAGCCTGGTTAGGG - Intergenic
1098155128 12:67589738-67589760 CACCATATCCAGCCTGGGAAAGG + Intergenic
1104388238 12:128369688-128369710 CTCAAGTTTCAGCCTTGGGATGG + Intronic
1105308867 13:19188791-19188813 GTCAATATGCAGCCTGGGACTGG + Intergenic
1105528728 13:21199360-21199382 GTCAATATGCAGCCTGGGACTGG - Intergenic
1105731000 13:23215447-23215469 CTTAGGATTCAGACTGGGTAAGG + Intronic
1107691489 13:42957862-42957884 TTAAATATTAAGGCTGGGTATGG - Intronic
1111081791 13:83321166-83321188 CTCAAAATTCAGCATGGCTGGGG + Intergenic
1111886310 13:94026270-94026292 CTCAAAATTGATCCTAGGTAAGG + Intronic
1119947838 14:78713647-78713669 CTCACTATTCAGCATGGCTGGGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124208386 15:27742483-27742505 CTCAGTCTTCAGCCTGGGATGGG - Intergenic
1124703870 15:31943940-31943962 CTCATAATTCAGTCTTGGTAAGG - Intergenic
1127759763 15:62127335-62127357 CTCAATATCCAGACAAGGTAAGG + Intergenic
1127819817 15:62644874-62644896 CTCAGTTTTTAGCCTGGGAAGGG + Exonic
1128256209 15:66198902-66198924 GTCAGCATTCAGCCTGGGCATGG - Intronic
1128737858 15:70063469-70063491 TTAAAAAGTCAGCCTGGGTAGGG + Intronic
1130007759 15:80117510-80117532 CTGAGTATTCAGGCTGGGCACGG - Intronic
1130514349 15:84614773-84614795 CTCTATATTCAGGCTGGGTGTGG - Intronic
1131848840 15:96516335-96516357 CTGAATAATCAGTCTGGGTGCGG - Intergenic
1133742539 16:8662331-8662353 AACAATATTCACCCTGGGCAGGG - Intergenic
1134141670 16:11725196-11725218 CACAATATTCAGGCAGGGTATGG - Intronic
1134631971 16:15762900-15762922 CACAATATACAGCCTGGGCTGGG + Intronic
1135744570 16:25005204-25005226 AACAATATTCAGGCTGGGTATGG - Intronic
1139576905 16:67847440-67847462 CTCCAGAGTCAGCATGGGTAAGG + Exonic
1141607300 16:85161546-85161568 CACAAAATGCAGCCTGGGTGTGG - Intergenic
1144451258 17:15381176-15381198 CTCAAGATTCAGGCAGGGCACGG - Intergenic
1146776171 17:35619350-35619372 TTAAAAATTCAGGCTGGGTATGG + Intronic
1150262135 17:63802618-63802640 AACAAAATTCAGGCTGGGTATGG + Intronic
1151546781 17:74798144-74798166 TTAAAAATGCAGCCTGGGTAGGG - Intronic
1157805463 18:50654692-50654714 CTCAGCCTTCAGCCTGGGCAGGG + Intronic
1158634505 18:59144989-59145011 CTCAAGATTCAACATGGGTTTGG - Intronic
1159498564 18:69238371-69238393 CTCACAATTCAGCCTGGCTGGGG + Intergenic
1159611596 18:70531770-70531792 CTCACAGTTCAGCATGGGTAGGG - Intergenic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1162752076 19:12835038-12835060 CCCAAGATTCAGGCTGGGGATGG - Intronic
1163135339 19:15307065-15307087 CTCAAAATTCAGGATGGGCAAGG + Intronic
1166174174 19:41053961-41053983 CTAAATAATCAGGCTGGGTGCGG - Intergenic
1168146319 19:54421557-54421579 CTCAATTTGCAGCCAGGGTCGGG - Intronic
1202704184 1_KI270713v1_random:9206-9228 CTCAATATGCAGTCTGGCTGTGG - Intergenic
926456624 2:13074966-13074988 CTCACCATTCAGCCTGGCTTGGG + Intergenic
926929392 2:18022440-18022462 CTCAAAATTGAGCCTTGGTTGGG + Intronic
927324274 2:21785128-21785150 CCCAATCTTCTGCCTGGGTGAGG - Intergenic
927656759 2:24954645-24954667 ATCAATAGTCAGGCTGGGTGCGG + Intronic
928909965 2:36409613-36409635 AACACTATTCAGACTGGGTATGG - Intronic
930451989 2:51553073-51553095 CTCAATATTCAGTCAATGTAAGG - Intergenic
931252655 2:60547760-60547782 CTCAATATTCAGCCTGGGTAGGG - Intronic
932347637 2:71006114-71006136 CTCAATATTTGGCCAGGGTGTGG - Intergenic
934930660 2:98419994-98420016 CCCAATATGCAGCCAGGTTAGGG + Intergenic
936467837 2:112769336-112769358 ATCAAAATACAGGCTGGGTACGG + Intergenic
938956639 2:136305075-136305097 GTCAATACTCAGCCTGAATAAGG + Intergenic
942668531 2:178348482-178348504 GTCCATATCCAGCCTGGGCAAGG + Intronic
1169302052 20:4451601-4451623 CCCAATATTCAGAATGGGTGGGG - Intergenic
1169348772 20:4851273-4851295 CTGAGTATTCAGACTGGGTCAGG - Intergenic
1170986698 20:21265722-21265744 CTCAATATCCAGCCTGGCTGAGG - Intergenic
1171355964 20:24545588-24545610 CTCAAGACTCAGCCGGGGGAGGG - Intronic
1173204623 20:40983029-40983051 CTCAATATCCCACCTGGGAAGGG + Intergenic
1174802356 20:53575051-53575073 CTCAAGAATAAGGCTGGGTATGG + Intronic
1175068863 20:56315119-56315141 TTCAATTTTCAGCCTGGTTGTGG - Intergenic
1175119400 20:56706705-56706727 CTCAATATTCCGCATGGGCTGGG + Intergenic
1178454181 21:32731849-32731871 AACAATATTCAGCCTGTGTTTGG + Intergenic
1182151198 22:28028284-28028306 CACAATACTCAGCCTGGCTGGGG + Intronic
1185179993 22:49353893-49353915 CTCAACATTCAGGATTGGTAGGG - Intergenic
949129176 3:480769-480791 CTGAAACTTCAGCCTGGGAAAGG - Intergenic
950917636 3:16662252-16662274 CTCACTGTTCAGCATGGCTAGGG - Intronic
952150692 3:30586791-30586813 CTCAATTTCCAGTTTGGGTATGG + Intergenic
954243374 3:49311451-49311473 CTCAAGATACAGCCTGGGAAAGG + Intronic
959363568 3:105427133-105427155 CTCCATTTTCACCCTGGGCATGG - Intronic
962529261 3:136263719-136263741 TTCAAACTTCAGCCTGGGCACGG + Intronic
964466742 3:157001063-157001085 CTCAAAGTTCAGCATGGCTAGGG - Intronic
965602851 3:170472076-170472098 TTCAATATTCTGGCTGGGCACGG + Intronic
965912913 3:173803324-173803346 TTCAATATTTACCCTGGGTGTGG + Intronic
966165297 3:177010002-177010024 CTTCACACTCAGCCTGGGTAAGG + Intergenic
967013775 3:185463540-185463562 CTCTCCATTCAGCCTGGGTAAGG - Exonic
976720502 4:88164602-88164624 CTCACAGTTCAGCCTGGCTAGGG - Intronic
978260841 4:106756609-106756631 TTCAGGATTCAGCCTTGGTAGGG + Intergenic
980418945 4:132533948-132533970 CTTGACATTCAGCCTGGGGATGG - Intergenic
984539262 4:181017280-181017302 CTCAAAATTCAGGCCGGGCATGG - Intergenic
986842829 5:11717638-11717660 CTCACAATTCAGCATGGCTAAGG + Intronic
987499076 5:18682335-18682357 CTCACAATTCAGCATGGCTAGGG - Intergenic
997834634 5:137182334-137182356 GTTAAGATTCAGCCTGGGGAAGG - Intronic
999192625 5:149759825-149759847 CTCAATATCCAGGGTGGGTGTGG - Intronic
999251370 5:150184183-150184205 CTTAGTATCCAGCCTGGGAAGGG - Exonic
1001911242 5:175520156-175520178 CTCAAAAGTCAGGCTGGGTGTGG - Intronic
1001918433 5:175581395-175581417 CTCATTGTTCAGCATGGCTAGGG + Intergenic
1003821298 6:9900093-9900115 ATCAATATCCAGGGTGGGTAAGG + Intronic
1007651164 6:43423346-43423368 CACAACATTCAGACTGGGCATGG + Intergenic
1009787566 6:68358802-68358824 CTCAATGTCCAGCAAGGGTAGGG + Intergenic
1010340810 6:74750255-74750277 CTCAATTCTCAGGCTGGGAAGGG + Intergenic
1015213176 6:130720899-130720921 ATCAAAATTCAGCCTGGGGATGG + Intergenic
1016787540 6:148028616-148028638 ATCTATTTTCAGCCAGGGTATGG + Intergenic
1020265906 7:6559911-6559933 CTCAATGTTTGGCCTGGGCAAGG - Intergenic
1020958929 7:14777643-14777665 CTCACAGTTCAGCCTGGCTAGGG - Intronic
1023450705 7:40282084-40282106 CTGGATATTCAGGCTGGGTGCGG - Intronic
1030090893 7:105857586-105857608 CACAGTATTTAGCCTGGGTCTGG - Intronic
1032664549 7:134022728-134022750 CTCACTATTCTGTCTGGGCAAGG - Intronic
1033080792 7:138295156-138295178 CTCACTGTTCAGCATGGCTAGGG - Intergenic
1033996705 7:147359074-147359096 CTAAATATTCAGCTTGTTTAGGG - Intronic
1036012496 8:4742323-4742345 CTCAAAATTCAGCCTTGGTCAGG - Intronic
1037896989 8:22663945-22663967 CTCTATCTTCAGCCGGTGTATGG - Intronic
1041501896 8:58548077-58548099 TTCAATATTCTGCCTGAGCAGGG + Intergenic
1045149478 8:99387693-99387715 ATAAATATTGAACCTGGGTATGG - Intronic
1045724416 8:105155482-105155504 CTGAAAATGGAGCCTGGGTAGGG - Intronic
1046288235 8:112124524-112124546 CTTAAAATTTAGGCTGGGTAAGG - Intergenic
1048233911 8:132672351-132672373 ACCAATATTGAGCCTGGGGATGG - Intronic
1049239472 8:141529785-141529807 CTCAATGTTCAACCAGGGTCAGG - Intergenic
1049554022 8:143273440-143273462 CTCACTCCTCAGCCTGGGTTCGG + Intronic
1049975408 9:857022-857044 GTTAATATTCAGGCTGGGTGTGG + Intronic
1050687854 9:8191327-8191349 CTCACTGCTCAGCCTGGGTGAGG - Intergenic
1052668401 9:31523542-31523564 CTCAATATTCTGAGTGAGTAAGG + Intergenic
1057494258 9:95547620-95547642 CTCAACATTGAGGCTGGGCATGG + Intergenic
1058442649 9:105024155-105024177 ATTAATATTCAGCCTGGGGTTGG + Intergenic
1058860281 9:109111006-109111028 AACAAAATTCAGCCTGGGAAAGG + Intronic
1062395902 9:136352698-136352720 CTCTTTATTCAGCCTGACTACGG - Intronic
1185718946 X:2366529-2366551 ATCAATATACAACCAGGGTAGGG + Intronic
1187146776 X:16644426-16644448 CTCAATTTACAGGCTGGGCATGG - Intronic
1198157927 X:133981161-133981183 CACAATAGCCAGCCTGGGCAAGG - Intronic
1198723207 X:139647467-139647489 TTCAATGTTCAGCCTGGGTAGGG + Intronic
1201529348 Y:14975241-14975263 CTCACTCCTCAGCCTGGGGATGG - Intergenic