ID: 931252931

View in Genome Browser
Species Human (GRCh38)
Location 2:60549996-60550018
Sequence CGAGCTCCGAGGCGAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931252922_931252931 23 Left 931252922 2:60549950-60549972 CCTGCCCGCATCATTATGATGAT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
931252923_931252931 19 Left 931252923 2:60549954-60549976 CCCGCATCATTATGATGATAACT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
931252924_931252931 18 Left 931252924 2:60549955-60549977 CCGCATCATTATGATGATAACTA 0: 1
1: 0
2: 0
3: 17
4: 197
Right 931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931252931 Original CRISPR CGAGCTCCGAGGCGAGAGGG GGG Intronic
900473922 1:2867588-2867610 AGAGCTCCGAGGCTTGTGGGAGG + Intergenic
900800791 1:4735818-4735840 CCAGCTCCGAGGCCAGAGGCAGG - Intronic
902610779 1:17596049-17596071 AGGGCTCCCAGGCGTGAGGGGGG - Intronic
903133508 1:21294113-21294135 CGAGCCCCGCGGCGAGAAAGTGG + Intronic
905107450 1:35573100-35573122 CGAGCTGCGAGCCCAGAAGGCGG + Intergenic
911023425 1:93411739-93411761 TGAGGTCCGAGGGGAGTGGGTGG + Intergenic
913201458 1:116498056-116498078 CGAGCTCAGGGGCTAGAGGAGGG - Intergenic
915835267 1:159171427-159171449 CGAGCTCCCGGGGGAGAGGGTGG + Intergenic
916492298 1:165312670-165312692 CGAGCTCCCAGGCAAGAGCCAGG + Intronic
924418298 1:243882790-243882812 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
924539944 1:244970899-244970921 CGAGACCCCAGGCGAGAGTGTGG - Exonic
924937286 1:248782900-248782922 TGAGGTCCGAAGGGAGAGGGTGG - Intergenic
1069705523 10:70456893-70456915 GGAGCTCTGAGGCCAGCGGGTGG + Intergenic
1073787896 10:106910343-106910365 CGAGCTCACAAGCGAGAGAGAGG + Intronic
1075124285 10:119687314-119687336 AGAGCTACGGGGTGAGAGGGGGG - Intergenic
1075512909 10:123086763-123086785 GGAGCTCAGAGGAGTGAGGGAGG + Intergenic
1076438626 10:130463646-130463668 TGAGGTCCGAGGGGAGTGGGTGG + Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077488840 11:2851239-2851261 GGAGCTCCGAGGCAACAGGCAGG - Intergenic
1080385698 11:31810068-31810090 GGAGCTCAGAGCCGAGCGGGAGG - Intronic
1091923119 12:4321383-4321405 CGAGCAGGGAGGGGAGAGGGTGG - Intronic
1101400372 12:104381935-104381957 AGACCTCCGAGGCGGGAGGTAGG + Intergenic
1101820907 12:108183724-108183746 CGAGGTCAGAGGTCAGAGGGTGG + Intronic
1102546880 12:113663684-113663706 TGAGCTCCGAGACGAAAGGGAGG + Intergenic
1113861874 13:113491549-113491571 GGAGCCCCGAGGAGAGAGAGAGG - Intronic
1119410346 14:74426261-74426283 GGAGCACGGAAGCGAGAGGGAGG - Intergenic
1125546702 15:40511555-40511577 CAAGCTCCGAGGCGGGCTGGGGG + Intergenic
1126830085 15:52593039-52593061 GGAGCTCCAAGGCAAGAGGATGG + Intronic
1128304017 15:66586407-66586429 CCAGCACCGAGGGGAGACGGTGG + Intronic
1128383946 15:67133950-67133972 CAAGCACCCAGGAGAGAGGGGGG - Intronic
1128501336 15:68229474-68229496 CGCGCGCCGGGGTGAGAGGGCGG - Intronic
1129784428 15:78299656-78299678 AGTGCTCCGAGCCGTGAGGGCGG - Exonic
1132650972 16:1021327-1021349 CGGGCTCAGGGGTGAGAGGGGGG - Intergenic
1133220273 16:4316588-4316610 CGTGCGGCGAGGTGAGAGGGGGG + Intronic
1134625392 16:15719302-15719324 CGAGGTCCTAGGTGGGAGGGAGG + Exonic
1135577491 16:23596960-23596982 CGAGGTCTGAGGGGAGTGGGTGG + Intergenic
1203141756 16_KI270728v1_random:1771571-1771593 CCAGCTCCGGGGGGAGAGTGTGG + Intergenic
1142521915 17:510825-510847 CTAGCTCGGAGGCCAGAGGAGGG - Exonic
1142587076 17:980191-980213 AGAGCTCCGCGGGGAGGGGGCGG - Intergenic
1144949369 17:18985673-18985695 CAAGCTCAGAGGCGAGAATGAGG + Intronic
1147393124 17:40122208-40122230 CGAGCTCCGGGGCGGGGGGCCGG + Intergenic
1147562092 17:41515569-41515591 TGAGCTCCGATGCGAGATGGAGG - Exonic
1148323298 17:46770166-46770188 CCAGCCCTGAGGCAAGAGGGAGG + Intronic
1148904122 17:50900718-50900740 CGAGCTGGGAGGGGAGGGGGGGG + Intergenic
1150008311 17:61483245-61483267 GGAGCTCTGAGCGGAGAGGGTGG - Exonic
1151306016 17:73263064-73263086 CCAGCTCCAGGGCTAGAGGGTGG + Intergenic
1151408184 17:73902788-73902810 GGAACTCCGAGGGGAGAGGCCGG - Intergenic
1151919116 17:77140768-77140790 CGAGCTCCGACCCGCGAGCGTGG - Intronic
1152103554 17:78316303-78316325 TGTGCTCCGAGCCGGGAGGGAGG - Intergenic
1154105501 18:11519149-11519171 GGAGCTGCGAGGTGAGAGCGAGG + Intergenic
1157216879 18:45791564-45791586 CTAGCCCCCAGGCAAGAGGGGGG - Intergenic
1160191994 18:76722385-76722407 TGAGGTCCGAGGAGAGTGGGTGG - Intergenic
1160930165 19:1566678-1566700 CGAGCTGCGGGGCGGGCGGGCGG - Intronic
1161266948 19:3368554-3368576 AGAGCTCCCAGGCCAGAGTGGGG + Intronic
1161847158 19:6718561-6718583 GGAGGTGCGAGGGGAGAGGGGGG + Intronic
1162000468 19:7741814-7741836 AGAGCTCCAAGGGGAGAGAGAGG + Exonic
1163442069 19:17327391-17327413 GCAGCTGGGAGGCGAGAGGGCGG - Intronic
1165469518 19:35995351-35995373 CGGGCGCCGAGGCGCGAGTGCGG + Exonic
1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG + Exonic
1166161826 19:40959765-40959787 AGAGCACCAAGGAGAGAGGGAGG - Intergenic
1166347774 19:42177033-42177055 GGGGCTGCGAGGGGAGAGGGAGG + Intronic
1166782696 19:45350712-45350734 CCGGCTCCGAGGCGAGGCGGCGG + Exonic
1167575898 19:50317261-50317283 CGGGCTCCTAGTCCAGAGGGGGG - Intronic
1168252655 19:55149250-55149272 CCCGCCCCGAGGGGAGAGGGAGG + Exonic
928132721 2:28664766-28664788 TGAGATCCGAGGGGAGTGGGTGG - Intergenic
929670904 2:43875927-43875949 CAGGCTCAGAGGTGAGAGGGTGG - Intronic
931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG + Intronic
932572463 2:72945270-72945292 TGAGCCCCGCGGCGGGAGGGCGG - Intronic
942890352 2:180980590-180980612 CAAGTTCCGAGGCGAGCGCGGGG - Exonic
948966267 2:241383159-241383181 CCAGCTCCGACGGCAGAGGGTGG - Intronic
1171012542 20:21516447-21516469 CGAGCTCCCACGTGAAAGGGCGG - Intergenic
1175945511 20:62556723-62556745 CGAGCTGGCAGGCGAGGGGGTGG - Intronic
1176366117 21:6033924-6033946 CGAGCTCCGGGGCAGGCGGGCGG + Intergenic
1178888424 21:36500244-36500266 CGAGCTCCCGGCTGAGAGGGCGG - Intronic
1179757400 21:43504621-43504643 CGAGCTCCGGGGCAGGCGGGCGG - Intergenic
1182278653 22:29205905-29205927 CCAGCTCCGCGGCCGGAGGGCGG - Exonic
1182880050 22:33725292-33725314 GGAGCACAGAGGCGACAGGGTGG + Intronic
1183180222 22:36255013-36255035 AGAGCCCTGAGGCGGGAGGGAGG + Intronic
1184145647 22:42608651-42608673 CAAGCAGCGAGGCGAGCGGGTGG + Intronic
954076823 3:48187872-48187894 CGGGCTGCGACGCGGGAGGGGGG + Exonic
959649418 3:108737244-108737266 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
960110096 3:113837517-113837539 ACAGCTCCAAGGCGAGAAGGAGG + Intronic
964148686 3:153497760-153497782 CGAGAGCTGAGGGGAGAGGGAGG - Intronic
964850987 3:161095897-161095919 TGAGGTCCGAGGGGAGTGGGTGG - Intronic
969040101 4:4289422-4289444 CTACCTCTGAGGAGAGAGGGAGG - Intronic
972960796 4:44449050-44449072 CGGGCTCCGACGCTAGGGGGCGG + Intergenic
980343745 4:131584562-131584584 TGAGGTCCGAGGGGAGTGGGTGG + Intergenic
980990584 4:139735462-139735484 CGACCTCCGGGGGGGGAGGGTGG + Intronic
984285955 4:177728890-177728912 TGAGGTCCGAGGGGAGTGGGTGG - Exonic
985248090 4:187996661-187996683 CGAGCTGCAGGGCGAGGGGGTGG + Intronic
985875736 5:2592401-2592423 CGAGCTGAGAGGCGGGAGAGGGG - Intergenic
992225511 5:74616493-74616515 TGAGGTCCGAGGGGAGTGGGTGG + Intergenic
994719753 5:103366925-103366947 TGAGGTCCGAGGGGAGTGGGTGG + Intergenic
994912952 5:105936947-105936969 TGAGCTGAGTGGCGAGAGGGAGG - Intergenic
998143255 5:139711420-139711442 CGCGCTCCGAGGGGAGGGCGGGG + Intergenic
999775683 5:154811448-154811470 GAAGCTCAGAGGAGAGAGGGAGG - Intronic
1000370112 5:160527283-160527305 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
1001664861 5:173424164-173424186 CAAGCTCAGAGGCAAGAGGCAGG - Intergenic
1004614966 6:17281098-17281120 CGAGCGCCGAAGCGGGCGGGGGG - Intergenic
1005327854 6:24720183-24720205 CGGGCTCCGCGGGGACAGGGAGG - Exonic
1012307084 6:97672169-97672191 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
1014270005 6:119326052-119326074 TGAGGTCCGAGGGGAGTGGGTGG + Intronic
1016863716 6:148746884-148746906 CGAGACCCGAGCGGAGAGGGAGG + Intergenic
1018031615 6:159845769-159845791 TGAGCTTCCAGGCGAGAAGGAGG - Intergenic
1021231082 7:18086845-18086867 CGAGCTGCGAGCTGAGCGGGCGG - Intergenic
1022741796 7:33129252-33129274 CACGCACCGAGGGGAGAGGGCGG + Intronic
1029494535 7:100889872-100889894 CGAGCTCCGAGGCGGGCGCAAGG - Intergenic
1029652982 7:101906430-101906452 CGAGGTCCGAGGGGAAAGGAGGG + Intronic
1031515429 7:122692716-122692738 TGAGGTCCGAGGGGAGTGGGTGG + Intronic
1033390623 7:140924522-140924544 CGAGCCCGGAGTCGGGAGGGCGG + Intronic
1035890908 8:3341603-3341625 TGAGGTCCCAGGAGAGAGGGAGG + Intronic
1041712435 8:60906612-60906634 AGAGCTCCCTGGCTAGAGGGTGG + Intergenic
1045367701 8:101492520-101492542 CGAGCTCGGAGGCGGCCGGGCGG - Exonic
1049216256 8:141409717-141409739 CCAGCTCCCAGGAGAGAAGGAGG - Intronic
1049664219 8:143835843-143835865 CGAGCTCCGAGGCGAGGTCCTGG + Exonic
1052048527 9:23821682-23821704 CGAGCTCCGCGGAGAGGCGGTGG + Intronic
1052854876 9:33401085-33401107 GGACCTCAGAGGCGAGTGGGTGG + Intronic
1053682895 9:40497414-40497436 GGACCTCAGAGGCGAGTGGGTGG + Intergenic
1054280819 9:63127514-63127536 GGACCTCAGAGGCGAGTGGGTGG - Intergenic
1054394011 9:64637409-64637431 GGACCTCAGAGGCGAGTGGGTGG + Intergenic
1054428660 9:65142621-65142643 GGACCTCAGAGGCGAGTGGGTGG + Intergenic
1054501719 9:65878921-65878943 GGACCTCAGAGGCGAGTGGGTGG - Intronic
1057152426 9:92807831-92807853 CGAGGTGCGGGGCGTGAGGGCGG + Intergenic
1057346982 9:94259750-94259772 AGACCTCCGAGGCGCGATGGTGG - Intronic
1057564101 9:96153149-96153171 CGAGGTCCAAGGCTAGAGAGTGG + Intergenic
1059769628 9:117414059-117414081 GCAACTCCGAGGCGAGAGCGAGG + Intronic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1203785914 EBV:127505-127527 CCAGCGCCGAGGCAAGAGTGGGG - Intergenic
1190261669 X:48801661-48801683 CGAGCTCACAGGCGACGGGGCGG - Intronic
1193022284 X:76803097-76803119 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
1197626461 X:128807754-128807776 TGAGGTCCGAGGGGAGTGGGTGG - Intergenic
1199552325 X:149073867-149073889 TGAGGTCTGAGGGGAGAGGGTGG - Intergenic