ID: 931252991

View in Genome Browser
Species Human (GRCh38)
Location 2:60550258-60550280
Sequence CAGCTCGCGCACGGGGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931252980_931252991 29 Left 931252980 2:60550206-60550228 CCGAAAGAAAGCGAAAACTGCAC 0: 1
1: 0
2: 0
3: 7
4: 186
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
931252985_931252991 -5 Left 931252985 2:60550240-60550262 CCCGGCGCGCGCTGGTCTCAGCT 0: 1
1: 0
2: 0
3: 2
4: 91
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
931252979_931252991 30 Left 931252979 2:60550205-60550227 CCCGAAAGAAAGCGAAAACTGCA 0: 1
1: 0
2: 0
3: 22
4: 253
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
931252986_931252991 -6 Left 931252986 2:60550241-60550263 CCGGCGCGCGCTGGTCTCAGCTC 0: 1
1: 0
2: 1
3: 1
4: 92
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
931252984_931252991 0 Left 931252984 2:60550235-60550257 CCGAGCCCGGCGCGCGCTGGTCT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
931252982_931252991 7 Left 931252982 2:60550228-60550250 CCGTGCTCCGAGCCCGGCGCGCG 0: 1
1: 0
2: 1
3: 10
4: 159
Right 931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931252991 Original CRISPR CAGCTCGCGCACGGGGGTGT CGG Intronic
901438527 1:9263836-9263858 CCGCTCCCGCACAGGGCTGTAGG - Exonic
902549103 1:17208668-17208690 GAGCTAGCCCACTGGGGTGTGGG - Intronic
913661747 1:121010905-121010927 GAGCGCGCGCACCGGGGTGGAGG - Intergenic
914013120 1:143794085-143794107 GAGCGCGCGCACCGGGGTGGAGG - Intergenic
914164706 1:145167100-145167122 GAGCGCGCGCACCGGGGTGGAGG + Intergenic
914651744 1:149702694-149702716 GAGCGCGCGCACCGGGGTGGAGG - Exonic
920409706 1:205749779-205749801 CTGCTGGCGCGCGGGGGTGGTGG - Intronic
1062864299 10:837639-837661 CTGCCCGTGCACGTGGGTGTTGG - Intronic
1064437566 10:15324548-15324570 CAGCTAGCGCACGGGGCTGCAGG - Intronic
1079970220 11:27027451-27027473 CAGATCCCCCACGAGGGTGTTGG + Intergenic
1091338776 11:134794419-134794441 CAGCTCTGGCACAGGGGTCTAGG + Intergenic
1097678984 12:62631901-62631923 CAGCGCGGGGGCGGGGGTGTAGG + Intergenic
1104890489 12:132137291-132137313 CAGCTCGGGCACAGGAGTGCGGG - Exonic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1108984287 13:56563834-56563856 CAGCTCACGCACGTGGCTGTTGG + Intergenic
1113574566 13:111385608-111385630 CTGCTCCCGTACGGGGCTGTGGG - Intergenic
1130923213 15:88366215-88366237 CACCTCCCTCACGGGGCTGTGGG - Intergenic
1131094794 15:89648420-89648442 CAGCTCGCGCAAGAGGCTGTAGG + Exonic
1147725727 17:42565155-42565177 CAGCCCGAGCAAGGTGGTGTTGG - Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1152259995 17:79261678-79261700 CAGCTCGCACACAGGCGGGTGGG + Intronic
1162925647 19:13929627-13929649 CAGCTGGAGCAGGGGGGTGTGGG + Exonic
1165745602 19:38228443-38228465 CAGCCAGCGCACGGGGTTGGGGG + Intronic
1165806694 19:38584731-38584753 CAGCACGGGCAGGGGGGTGAGGG - Intronic
1166101948 19:40576384-40576406 CCGCTGGGGCCCGGGGGTGTGGG + Exonic
1168232605 19:55042758-55042780 AAGCTCACGCACGTGGTTGTTGG + Intronic
931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG + Intronic
933560123 2:83877501-83877523 CAGTTAGGGCACGGGCGTGTTGG + Intergenic
939331070 2:140761686-140761708 AAGCTCGCTCATGGGGCTGTTGG - Intronic
948980548 2:241492248-241492270 CAGCCCCCTCACGGGGGTGCTGG - Intronic
1174134200 20:48367684-48367706 CAGCTCACGGACGGGTGTGGGGG + Intergenic
1174657866 20:52186806-52186828 CAGCTGGAGCATGGGGGAGTCGG - Intronic
1179311739 21:40202162-40202184 CAGCTCCCACACAGGGTTGTTGG - Intronic
953771225 3:45779921-45779943 CCGCTCGGGGAAGGGGGTGTGGG - Intronic
962887906 3:139644914-139644936 CAGCTCGCGGCCGGGAGTGGTGG + Intronic
967858920 3:194137410-194137432 CACATCGCGCGCGGGGGTGGGGG + Intronic
969619168 4:8270309-8270331 CAGCTGGCGCACGGGCGTCCCGG - Exonic
969629757 4:8329316-8329338 CAGTTAGGGCATGGGGGTGTAGG + Intergenic
989139481 5:38189033-38189055 CAGCTAGCACAGGGGGGTCTGGG + Intergenic
1002827196 6:784601-784623 CAGCTGGAGCAAGGGGTTGTTGG - Intergenic
1003049470 6:2766243-2766265 CAGCCAGCGCCCGGGGGTGCGGG - Exonic
1004114038 6:12749557-12749579 AGGCTCGCGCACGGGGGAGGGGG - Intronic
1006401334 6:33819412-33819434 CAGGTCCAGCACGGGGGTGGGGG - Intergenic
1006510132 6:34516980-34517002 CAGCTCCTGCACGGGGGTCAAGG - Intronic
1017117056 6:150987605-150987627 CAGCTAGCGCAAGGGGGAGCAGG + Intronic
1019400057 7:847487-847509 CCGCTGGCGCACGGCGCTGTGGG - Intronic
1025188113 7:56876597-56876619 CAGCTGGGGCACGGGGGTCAGGG + Intergenic
1025683810 7:63700325-63700347 CAGCTGGGGCACGGGGGTCAGGG - Intergenic
1025806471 7:64838287-64838309 CAGTTAGGGCACGGGCGTGTTGG + Intergenic
1031624299 7:123974566-123974588 CAGCTAGAGCCCAGGGGTGTAGG + Intergenic
1034733999 7:153412279-153412301 CAGTTAGGGCACGGGTGTGTTGG + Intergenic
1037789002 8:21920002-21920024 CACCTCGCGCGCGGGGCTGCAGG + Intronic
1038360145 8:26866959-26866981 CAGCTCGCGCGCGGGGGATGTGG + Intronic
1039843277 8:41308584-41308606 CGGCTCGCGCACGTGGGAGGAGG + Intronic
1039852573 8:41382793-41382815 CAGCTCACTCAGGGGGTTGTTGG + Intergenic
1046840042 8:118846336-118846358 AAGCTCGCTCATGTGGGTGTTGG + Intergenic
1052973881 9:34398157-34398179 CAGCTCCCTCCCTGGGGTGTGGG - Intergenic
1055965423 9:81860954-81860976 CAGGTCCCCCACCGGGGTGTTGG + Intergenic
1060682562 9:125577831-125577853 CAGCTCCCGGACGGGGCGGTTGG - Intronic
1190493145 X:51002753-51002775 CAGCTCTTGCAGGGGTGTGTAGG - Intergenic
1190511351 X:51176912-51176934 CAGCTCTTGCAGGGGTGTGTAGG + Intergenic