ID: 931253309

View in Genome Browser
Species Human (GRCh38)
Location 2:60551521-60551543
Sequence CACAGCTCGGGACCGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931253309_931253314 6 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253314 2:60551550-60551572 AGACGTCTGAGAAAGTACCCAGG 0: 1
1: 0
2: 1
3: 5
4: 89
931253309_931253315 7 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253315 2:60551551-60551573 GACGTCTGAGAAAGTACCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
931253309_931253321 19 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253321 2:60551563-60551585 AGTACCCAGGGCGGAGGGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 309
931253309_931253319 15 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253319 2:60551559-60551581 AGAAAGTACCCAGGGCGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 171
931253309_931253324 23 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253324 2:60551567-60551589 CCCAGGGCGGAGGGGAGGGGAGG 0: 1
1: 0
2: 14
3: 192
4: 1780
931253309_931253317 13 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253317 2:60551557-60551579 TGAGAAAGTACCCAGGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 158
931253309_931253320 18 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253320 2:60551562-60551584 AAGTACCCAGGGCGGAGGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 183
931253309_931253318 14 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253318 2:60551558-60551580 GAGAAAGTACCCAGGGCGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 149
931253309_931253322 20 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253322 2:60551564-60551586 GTACCCAGGGCGGAGGGGAGGGG 0: 1
1: 0
2: 1
3: 48
4: 1071
931253309_931253316 10 Left 931253309 2:60551521-60551543 CCTCCTCGCGGTCCCGAGCTGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 931253316 2:60551554-60551576 GTCTGAGAAAGTACCCAGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931253309 Original CRISPR CACAGCTCGGGACCGCGAGG AGG (reversed) Intronic
901017901 1:6242262-6242284 CGCAGCTCGAGAACGCGGGGAGG + Intergenic
922951209 1:229559311-229559333 CTCAGCTCTGGACGGCGTGGAGG + Intergenic
1069486495 10:68827312-68827334 GGGAGCTCGGGACCTCGAGGCGG + Intergenic
1069574257 10:69515700-69515722 CACAGCTCGTGACCCCTTGGAGG + Intergenic
1075513764 10:123093489-123093511 GACAGCTGGGGACAGGGAGGAGG - Intergenic
1075617909 10:123904885-123904907 CAGAGCTCGGGCCCTCCAGGTGG - Intronic
1076879021 10:133230983-133231005 CACCGCCCGCGACCGCGACGCGG + Exonic
1077230616 11:1456810-1456832 CACAGCTCGGGGCAGGGAGGTGG - Intronic
1077368175 11:2169662-2169684 CACAGCTCGGGACAGCGCCGAGG + Exonic
1077440713 11:2567440-2567462 CTCAGCTGGGGACAGGGAGGAGG - Intronic
1084479693 11:69412439-69412461 CAGAGCTGGGGAGCGCAAGGCGG + Intergenic
1097269732 12:57766615-57766637 CACACCTCAGGACAGCGAGAAGG + Intronic
1104728425 12:131092209-131092231 CTCAGCCAGGGACCGAGAGGAGG + Intronic
1114408890 14:22482189-22482211 CACAGCCCTGGACTGCTAGGAGG + Intergenic
1121045511 14:90784838-90784860 CACAGCTCCAGGCCGCTAGGAGG - Intronic
1128635870 15:69302156-69302178 GATAGCTCGAGACCGGGAGGCGG - Intronic
1129462332 15:75705695-75705717 CACAGCTCAGGACTCAGAGGAGG + Intronic
1129722523 15:77886146-77886168 CACAGCTCAGGACTCAGAGGAGG - Intergenic
1130607494 15:85331203-85331225 CACAGCTCCGGAGCCTGAGGAGG - Intergenic
1132415059 15:101613687-101613709 CAGAGCACGTGACAGCGAGGAGG + Intergenic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1138252106 16:55509324-55509346 CGCAGATCGGCTCCGCGAGGCGG + Exonic
1140348968 16:74243411-74243433 CACAACTGGGGACAGCGAGGTGG + Intergenic
1142420784 16:89968280-89968302 AACAGCTTGGGCCCGGGAGGCGG - Intergenic
1142420795 16:89968312-89968334 AACAGCTTGGGCCCGGGAGGCGG - Intergenic
1148686847 17:49505904-49505926 CCCAGCTCTGGCCCGCGGGGAGG + Intronic
1148749785 17:49938878-49938900 CACAGCCCTGGACCGTGGGGAGG + Intergenic
1152161357 17:78670452-78670474 CACTGCTCAGGAGCACGAGGAGG + Intergenic
1152726399 17:81948879-81948901 CAGAGCTCGGGAGGGAGAGGGGG - Intergenic
1157284959 18:46371373-46371395 CACAGCCCAGGCCAGCGAGGAGG + Intronic
1160427880 18:78790715-78790737 CACAGATGGGGAGCGGGAGGAGG + Intergenic
1162126492 19:8502330-8502352 CTCAGGTTGGGACTGCGAGGGGG - Intronic
926801760 2:16665681-16665703 CACCGCGGGGCACCGCGAGGCGG - Intronic
931253309 2:60551521-60551543 CACAGCTCGGGACCGCGAGGAGG - Intronic
932476352 2:72008764-72008786 CACTGCTCGGGAGCACCAGGAGG + Intergenic
939612946 2:144332335-144332357 CGCAGCGCGGCCCCGCGAGGCGG + Intronic
949035312 2:241813435-241813457 CACAGCCCGGCACAGGGAGGTGG - Intronic
1169213638 20:3781525-3781547 CAAAGCTCGGGCCTGAGAGGAGG - Intergenic
1174521284 20:51132631-51132653 CACAGCTCGGGAATTGGAGGGGG - Intergenic
1175667253 20:60871034-60871056 CACAGCTGGGGGCTGAGAGGGGG + Intergenic
1175886108 20:62291843-62291865 CACACCTGGGGACGGCGGGGAGG + Intronic
1175886120 20:62291873-62291895 CACACCTGGGGACGGCGGGGAGG + Intronic
1176680686 21:9817643-9817665 CACACCTGGGAACCGGGAGGTGG + Intergenic
1176681537 21:9821874-9821896 CACACCTGGGAACCGGGAGGTGG + Intergenic
1176681824 21:9823283-9823305 CACACCTGGGAACCGGGAGGTGG + Intergenic
1178992734 21:37368001-37368023 CACTGGTGGGGACCGAGAGGAGG - Intronic
1179583243 21:42358349-42358371 CTCAGCTGGGGACCAGGAGGTGG + Intergenic
1185012169 22:48320426-48320448 CACAGCACGGCACGGGGAGGCGG + Intergenic
1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG + Intronic
1185338424 22:50281071-50281093 CACAGGTAGGGACCGCTTGGGGG - Exonic
954148444 3:48645825-48645847 GACAGCACGGGACTGCGAGCTGG - Exonic
967214346 3:187197820-187197842 CAGAGCTAGGGACCTAGAGGCGG - Intronic
967610480 3:191499930-191499952 CACAGCTCGGCACCCCGGGCAGG - Intergenic
972324031 4:37998419-37998441 GACAGCTGAGGACTGCGAGGTGG - Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
985542810 5:494640-494662 CACAGCTTGGGACACCAAGGCGG - Intronic
985645822 5:1084316-1084338 CACTACTCGGCACCGCGCGGTGG - Intronic
998285554 5:140857275-140857297 CAGCGCTCTGGACCGCGAGAGGG + Exonic
1006028929 6:31165060-31165082 CAGAGCTAGGGAAAGCGAGGTGG + Intronic
1006949320 6:37808574-37808596 CACAGCTGGGGATGGCAAGGTGG - Intergenic
1007591173 6:43021714-43021736 CGGGGCCCGGGACCGCGAGGAGG + Exonic
1013858729 6:114607795-114607817 CAGAGCTCAGGACCACGAGGGGG - Intergenic
1019194205 6:170271787-170271809 CACAGCTTGGGAGCACGAAGCGG + Intergenic
1020163983 7:5793883-5793905 CACAGCACGGGACTGGCAGGCGG + Intergenic
1020423267 7:8034951-8034973 CACAGCTCGGGTCCACAGGGAGG - Intronic
1022443614 7:30452615-30452637 CCCAGAGCGGGACCCCGAGGAGG - Exonic
1023251061 7:38261625-38261647 AACAGTTCGGGAGGGCGAGGGGG + Intergenic
1029513647 7:101012617-101012639 CTCAGCCTGGGACCGAGAGGGGG - Intronic
1033288685 7:140063039-140063061 CACAGCTGGGGGCCCTGAGGCGG - Exonic
1037980514 8:23250085-23250107 CACAGCTGGGGACCATGAAGGGG - Intronic
1040550046 8:48430562-48430584 CACAGCTCCAGTGCGCGAGGAGG + Intergenic
1049554325 8:143274617-143274639 CACAGCCCGGGAGCACGTGGCGG + Intronic
1056170336 9:83979693-83979715 GAGACCTCGGGACCGCGTGGTGG - Intronic
1203665561 Un_KI270754v1:18766-18788 CACACCTGGGAACCGGGAGGTGG + Intergenic
1203666710 Un_KI270754v1:24402-24424 CACACCTGGGAACCGGGAGGTGG + Intergenic
1203667859 Un_KI270754v1:30041-30063 CACACCTGGGAACCGGGAGGTGG + Intergenic
1203669852 Un_KI270754v1:39906-39928 CACACCTGGGAACCGGGAGGTGG + Intergenic
1189309493 X:40009572-40009594 CTCCGCTCGGGACCGGCAGGAGG + Intergenic