ID: 931261604

View in Genome Browser
Species Human (GRCh38)
Location 2:60624719-60624741
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931261604_931261609 12 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG No data
931261604_931261610 13 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261610 2:60624755-60624777 CTTCACGTGTGAATCTTTGTGGG No data
931261604_931261611 14 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261611 2:60624756-60624778 TTCACGTGTGAATCTTTGTGGGG 0: 1
1: 0
2: 2
3: 33
4: 612
931261604_931261612 21 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931261604 Original CRISPR CCTAATCCCACACCCACCAT GGG (reversed) Intergenic