ID: 931261606

View in Genome Browser
Species Human (GRCh38)
Location 2:60624720-60624742
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931261606_931261609 11 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG No data
931261606_931261610 12 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261610 2:60624755-60624777 CTTCACGTGTGAATCTTTGTGGG No data
931261606_931261613 30 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261613 2:60624773-60624795 GTGGGGAGCAAGGAAAAAAGAGG No data
931261606_931261611 13 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261611 2:60624756-60624778 TTCACGTGTGAATCTTTGTGGGG No data
931261606_931261612 20 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931261606 Original CRISPR CCCTAATCCCACACCCACCA TGG (reversed) Intergenic