ID: 931261608

View in Genome Browser
Species Human (GRCh38)
Location 2:60624743-60624765
Sequence CACACGTGAAGTCTCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931261608_931261611 -10 Left 931261608 2:60624743-60624765 CCTGAGATGAGACTTCACGTGTG No data
Right 931261611 2:60624756-60624778 TTCACGTGTGAATCTTTGTGGGG No data
931261608_931261612 -3 Left 931261608 2:60624743-60624765 CCTGAGATGAGACTTCACGTGTG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data
931261608_931261613 7 Left 931261608 2:60624743-60624765 CCTGAGATGAGACTTCACGTGTG No data
Right 931261613 2:60624773-60624795 GTGGGGAGCAAGGAAAAAAGAGG No data
931261608_931261614 24 Left 931261608 2:60624743-60624765 CCTGAGATGAGACTTCACGTGTG No data
Right 931261614 2:60624790-60624812 AAGAGGCAAATATGAGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931261608 Original CRISPR CACACGTGAAGTCTCATCTC AGG (reversed) Intergenic