ID: 931261609

View in Genome Browser
Species Human (GRCh38)
Location 2:60624754-60624776
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931261602_931261609 18 Left 931261602 2:60624713-60624735 CCAGAGCCCATGGTGGGTGTGGG No data
Right 931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG No data
931261604_931261609 12 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG No data
931261606_931261609 11 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type