ID: 931261612

View in Genome Browser
Species Human (GRCh38)
Location 2:60624763-60624785
Sequence GTGAATCTTTGTGGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931261602_931261612 27 Left 931261602 2:60624713-60624735 CCAGAGCCCATGGTGGGTGTGGG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data
931261604_931261612 21 Left 931261604 2:60624719-60624741 CCCATGGTGGGTGTGGGATTAGG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data
931261606_931261612 20 Left 931261606 2:60624720-60624742 CCATGGTGGGTGTGGGATTAGGG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data
931261608_931261612 -3 Left 931261608 2:60624743-60624765 CCTGAGATGAGACTTCACGTGTG No data
Right 931261612 2:60624763-60624785 GTGAATCTTTGTGGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931261612 Original CRISPR GTGAATCTTTGTGGGGAGCA AGG Intergenic