ID: 931274767

View in Genome Browser
Species Human (GRCh38)
Location 2:60734767-60734789
Sequence AGGTGTGTGGTACATGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931274767_931274770 -10 Left 931274767 2:60734767-60734789 CCAGTGTCATGTACCACACACCT No data
Right 931274770 2:60734780-60734802 CCACACACCTTTCTCCAAGGTGG No data
931274767_931274774 13 Left 931274767 2:60734767-60734789 CCAGTGTCATGTACCACACACCT No data
Right 931274774 2:60734803-60734825 TCTCATAATTCTAGAATGGAAGG No data
931274767_931274773 9 Left 931274767 2:60734767-60734789 CCAGTGTCATGTACCACACACCT No data
Right 931274773 2:60734799-60734821 GTGGTCTCATAATTCTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931274767 Original CRISPR AGGTGTGTGGTACATGACAC TGG (reversed) Intergenic
No off target data available for this crispr