ID: 931277035

View in Genome Browser
Species Human (GRCh38)
Location 2:60753183-60753205
Sequence ACAGATCATCACATACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931277033_931277035 3 Left 931277033 2:60753157-60753179 CCCAGTATTTGTGAATGTTTGAG No data
Right 931277035 2:60753183-60753205 ACAGATCATCACATACATATTGG No data
931277034_931277035 2 Left 931277034 2:60753158-60753180 CCAGTATTTGTGAATGTTTGAGA No data
Right 931277035 2:60753183-60753205 ACAGATCATCACATACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931277035 Original CRISPR ACAGATCATCACATACATAT TGG Intergenic
No off target data available for this crispr