ID: 931285869

View in Genome Browser
Species Human (GRCh38)
Location 2:60831054-60831076
Sequence CTGTATTAGTAAAGTTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931285869_931285874 2 Left 931285869 2:60831054-60831076 CCCTCTCAACTTTACTAATACAG No data
Right 931285874 2:60831079-60831101 AAGTTCAGGACTGAGGAATGTGG No data
931285869_931285873 -5 Left 931285869 2:60831054-60831076 CCCTCTCAACTTTACTAATACAG No data
Right 931285873 2:60831072-60831094 TACAGGTAAGTTCAGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931285869 Original CRISPR CTGTATTAGTAAAGTTGAGA GGG (reversed) Intergenic
No off target data available for this crispr