ID: 931289121

View in Genome Browser
Species Human (GRCh38)
Location 2:60856879-60856901
Sequence CCAGGCCCAGGTTAGATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931289116_931289121 3 Left 931289116 2:60856853-60856875 CCAGGCAGGACAGTGGTAGATGG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931289121 Original CRISPR CCAGGCCCAGGTTAGATAAT TGG Intergenic