ID: 931289121

View in Genome Browser
Species Human (GRCh38)
Location 2:60856879-60856901
Sequence CCAGGCCCAGGTTAGATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931289116_931289121 3 Left 931289116 2:60856853-60856875 CCAGGCAGGACAGTGGTAGATGG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931289121 Original CRISPR CCAGGCCCAGGTTAGATAAT TGG Intergenic
900269617 1:1780456-1780478 CCAGGCCCAGGGTAGACAAAGGG - Intronic
900334705 1:2156591-2156613 CCATCCCCAGGTTCGATGATTGG + Intronic
901690746 1:10971612-10971634 ACAGGACCAGGGTAGAGAATGGG - Intronic
908429359 1:64040918-64040940 CCAGGAGCAGGTTATTTAATGGG - Intronic
909728621 1:78867088-78867110 CCAGTCACAGGTTTGATAATTGG + Intergenic
910749432 1:90612785-90612807 CCAGGCACTGGTTAGATATTGGG - Intergenic
910888934 1:91996541-91996563 CCAGCCCCAGGTTTTATAATAGG + Intronic
911084906 1:93968243-93968265 CCAGCACCAGGTTCAATAATTGG + Intergenic
911683305 1:100744395-100744417 CCAGGCCCAGGTGACTTCATTGG + Intergenic
915899310 1:159834981-159835003 GCAGGCCAAGGTTAGATACTAGG + Exonic
916725381 1:167518092-167518114 GCAGGCCCAGGGTAGAGAAACGG - Intronic
922533932 1:226365877-226365899 CCAGGCCCAGGTTGGAGGAGTGG + Intronic
922606934 1:226895277-226895299 GCAGGACCAGGGAAGATAATGGG + Intronic
924031342 1:239888758-239888780 CCAAACCCAGGTTTGCTAATTGG + Intronic
1063686770 10:8244366-8244388 TCAGGCCCAGGTCAGTAAATTGG + Intergenic
1066098948 10:32099753-32099775 GCAGGACCAGGTGAGGTAATTGG - Intergenic
1069071405 10:63993849-63993871 CCAGGCCCACCATGGATAATAGG - Intergenic
1070278179 10:75028291-75028313 CCAGGCCTAGGTTATTTACTTGG + Intronic
1071215664 10:83397880-83397902 CCAAGTTTAGGTTAGATAATTGG - Intergenic
1071733195 10:88269494-88269516 CCAGGCCCTAGTTTGATGATGGG - Intergenic
1074183856 10:111084945-111084967 CCAGGCCCAGGTGAGCAAAGTGG - Intergenic
1074848636 10:117420971-117420993 CCAGGCCAAGGTTAGAAAGGCGG - Intergenic
1075507264 10:123035244-123035266 CCATGCCCAGCCTAGATAGTGGG + Intronic
1075726450 10:124613175-124613197 CCAGGCCCATGTTAGATGCTGGG + Intronic
1083526698 11:63373614-63373636 ACAGAAACAGGTTAGATAATGGG - Intronic
1085022222 11:73217111-73217133 CGTGGCCCAGCTTAGACAATAGG + Intergenic
1085767243 11:79293887-79293909 CTAGGACCAAGGTAGATAATGGG + Intronic
1087155422 11:94896985-94897007 CCAGCCACAGGTAAGATAATTGG + Intergenic
1089298904 11:117486180-117486202 GCAGACCCAGTTTAGCTAATTGG - Intronic
1089624593 11:119743102-119743124 CCAGGAACGGGTTAGATAGTAGG - Intergenic
1090465943 11:126933243-126933265 ACATGCCCAGGTTTGATGATAGG - Intronic
1095154141 12:38832385-38832407 GCAGTCCCAGTTTAGCTAATTGG - Intronic
1097067761 12:56333428-56333450 CAAGGATTAGGTTAGATAATGGG - Intronic
1097383102 12:58919647-58919669 CCAGGCCCAGGGGAGATAAGCGG - Intronic
1099404466 12:82243619-82243641 CAAGGCCTAGGTTAAAGAATTGG - Intronic
1100241304 12:92712775-92712797 CCAGGACCAGAGTATATAATTGG - Intergenic
1106347532 13:28893516-28893538 CCAGGCACAGGCTATATTATTGG + Intronic
1106363167 13:29050984-29051006 CCAGGCCCGGGTTAGAAGTTTGG + Intronic
1107802250 13:44119599-44119621 CCAGGCCTGGGGTAGATATTTGG + Intergenic
1111390244 13:87584793-87584815 CGAGGCCCATGTTAGAGAGTTGG + Intergenic
1112311376 13:98320171-98320193 CCAGGCCCACGTATGAGAATGGG - Intronic
1121339869 14:93098957-93098979 ACAGGCCCTGGTTAGAGTATGGG - Intronic
1122145363 14:99685347-99685369 CCAGGCCCAGGCTTGAGAAAAGG - Intronic
1123821135 15:24031546-24031568 CCAGGGCCAGGTTTGGGAATGGG - Intergenic
1126940699 15:53762178-53762200 CCAGGCCCAAGTAAGATCACAGG + Intronic
1128727842 15:70000835-70000857 CCAGGCCCAGGCAAGACAACAGG + Intergenic
1132894304 16:2220779-2220801 CCAGGCTCAGGTAAGGTGATCGG - Intergenic
1135248491 16:20879024-20879046 CCAGGCCCAGTTATGATATTTGG + Intronic
1142320853 16:89382035-89382057 CCAGGCCCAGGGAAGGTGATGGG + Intronic
1147911831 17:43860568-43860590 CCAGGCCCGGGTCAGAATATGGG + Intronic
1153228114 18:2912973-2912995 CCAGGCCCAGGTTAATCACTGGG + Intronic
1153655551 18:7278858-7278880 ACAGGTCCAGGTTTGAAAATAGG - Intergenic
1161984348 19:7645488-7645510 CCAGTCCCAGCTTACACAATAGG + Intronic
1167555216 19:50190427-50190449 CAAGACCCACCTTAGATAATGGG - Intronic
1168137646 19:54361888-54361910 CCAAGCCCAGTTGAGATAAATGG - Intronic
1168160424 19:54507190-54507212 CCAAGCCCAGTTGAGATAAATGG + Intronic
931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG + Intergenic
932476903 2:72011999-72012021 CCAGGCCCTTGCTAGATATTGGG - Intergenic
935125686 2:100220501-100220523 CCAGACCCAGGAAAGCTAATGGG - Intergenic
939623266 2:144446568-144446590 CCAGGCACTGGATAGATAATTGG - Intronic
942250907 2:174047049-174047071 GCAGGGCCAGGTTAGGAAATGGG + Intergenic
942477416 2:176342559-176342581 CCAGGCCCAGGTGGTAAAATTGG - Intergenic
943246860 2:185465090-185465112 CCAGGCCCAGATGAGCTTATTGG + Intergenic
943443112 2:187950138-187950160 CCAATCACAGGTTATATAATAGG + Intergenic
944861396 2:203818953-203818975 CCAAGCTCATGTTAGAAAATTGG - Intergenic
945316431 2:208376033-208376055 CCATGCCCAGGTTACCTGATGGG - Intronic
948978968 2:241483012-241483034 CCAGGAGCAGGTTCGAGAATGGG - Intronic
1169022133 20:2338133-2338155 TCAGTACCAGGTTAGATAATGGG - Intronic
1171103651 20:22411003-22411025 CCAGGCCCTGTTTAGATTATTGG - Intergenic
1172094818 20:32455504-32455526 CCGGGCCCAGGTTGGAGAAGAGG + Intronic
1173427292 20:42954264-42954286 GAAGGCACAGGTTAGATAACAGG - Intronic
1176910563 21:14559962-14559984 CCAGGCCCATAATAGATATTTGG - Intronic
1180456391 22:15514905-15514927 ACAGGCCCCAGTTAGAAAATAGG + Intergenic
1183914508 22:41106394-41106416 CCAAGGCCAGGTTAGAGATTTGG - Intronic
949313010 3:2721260-2721282 CCACGCCCAGCCAAGATAATTGG + Intronic
953425484 3:42793609-42793631 CCATCCTCAGGTTAGATGATTGG - Intronic
954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG + Intronic
954870029 3:53760859-53760881 CAAGGCTCTGGCTAGATAATGGG + Intronic
956864280 3:73353833-73353855 CCAGGCCCAGGCTGGGTAAGTGG - Intergenic
960542993 3:118881380-118881402 CCAGGACCATGTTAGAACATTGG - Intergenic
960713582 3:120555128-120555150 CCAGGGCCAGGTAAGATAGGAGG + Intergenic
966749981 3:183312827-183312849 CCAGGGCCAGGTTTGAGGATGGG - Intronic
966913371 3:184571453-184571475 CCAGGCCCTGGTGAGATGAGGGG - Intronic
968252229 3:197230020-197230042 GCAAGCCAAGGTTAGATATTTGG + Intronic
979613907 4:122719779-122719801 TCAAGCCCAGGTTAGATGAAGGG + Intergenic
980551891 4:134347500-134347522 TCAGGCCCAGGTGAGAAAAGTGG + Intergenic
981823157 4:148909308-148909330 TTAGTCCCAGGTTGGATAATTGG - Intergenic
986334157 5:6740768-6740790 CCAGGCCCAGGTTCCAGAAGGGG + Intronic
986677175 5:10196224-10196246 CCAGGCCCAGTTTAGTGACTGGG - Intergenic
986964017 5:13248326-13248348 CCAAGACCAGATTAGATAAAGGG - Intergenic
987228566 5:15868996-15869018 CCAGGCACAGGTTAGCTAGGGGG + Intronic
990916961 5:60917411-60917433 CCAGGCTGAGTTTAGACAATGGG + Intronic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
995659766 5:114468023-114468045 CCAGGCCCAGGCTTAATAACTGG + Intronic
999023272 5:148194573-148194595 AAAGGTCCAGGTTAGATAATGGG - Intergenic
1000446646 5:161330768-161330790 CCAAGCCCAGGGAAGAGAATGGG - Intronic
1000997433 5:167973690-167973712 CCAGGCAAAGGTGAGAGAATAGG + Intronic
1001643653 5:173263785-173263807 CCAGGCCCAGGGTAGCTCAAAGG + Intergenic
1001736383 5:174007101-174007123 CCAGGCCCTGGGTGTATAATTGG + Intergenic
1002823534 6:752116-752138 CCAGGCCAAACTTATATAATTGG - Intergenic
1002942927 6:1733691-1733713 CCAGGCCCAGCTGGGACAATAGG - Intronic
1004129726 6:12908159-12908181 CCAGGCCCAGGTGCGATTCTTGG - Intronic
1004350709 6:14888032-14888054 CCAAGCCCAGGTTTGATTTTAGG - Intergenic
1013515031 6:110876669-110876691 CCAGGCTCACGTGAGATTATAGG + Intronic
1013770508 6:113622855-113622877 CCAGGTACAGGTTAGGTATTAGG + Intergenic
1015688079 6:135889192-135889214 CCAGGCCTATGTTAGAGTATAGG + Intronic
1022098094 7:27153109-27153131 CCAGCCCCAGGCTAGGAAATGGG - Intergenic
1023541918 7:41274974-41274996 CCAGGCCCAGGCTTTATAAAAGG + Intergenic
1023878133 7:44302282-44302304 CCAGGCCCAGATTGGTTCATTGG + Intronic
1026760612 7:73123173-73123195 CCTGGCCCAGGTGAGACATTCGG + Intergenic
1027036956 7:74931994-74932016 CCGGGCCCAGGTGAGACATTCGG + Intergenic
1027086608 7:75269465-75269487 CCGGGCCCAGGTGAGACATTCGG - Intergenic
1027824653 7:83095072-83095094 CCAGGTCCAGATTATTTAATTGG - Intronic
1029392908 7:100287468-100287490 CCGGGCCCAGGTGAGACATTCGG - Intergenic
1030710460 7:112742824-112742846 CCACCCCAAGGTTAGATAATTGG - Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1046189508 8:110774131-110774153 CCAGGCACATGCTAGATAAAAGG + Intergenic
1050277100 9:4011286-4011308 CCAGGCCCAGGGGAGAGAACAGG + Intronic
1057558203 9:96105799-96105821 CCAGGCCCAGATGAGTTCATTGG + Intergenic
1058056049 9:100449918-100449940 CCAGGGACAGGTTAAATAAGAGG + Intronic
1060786910 9:126458260-126458282 CCAGGCCCAGGATAGAGACCAGG + Intronic
1185515698 X:697421-697443 TCAGGCCCTGGAAAGATAATAGG - Intergenic
1186946747 X:14577232-14577254 CAAGGCCCAAGTTAGCAAATAGG + Intronic
1187156381 X:16724043-16724065 CCATCCCCAGGTTTGATGATTGG + Intronic
1189205185 X:39231965-39231987 ACATGCCCAGGTTAGCTATTAGG + Intergenic
1190211001 X:48447810-48447832 CCAGATCCAGGTTACTTAATGGG - Intergenic
1191095894 X:56672596-56672618 CCAGTGCCAGAATAGATAATTGG - Intergenic
1192559548 X:72117064-72117086 CAAGACCCAGGTCAGATGATTGG + Intergenic
1194466755 X:94242931-94242953 CCAGGCCCAGGATATTTACTGGG + Intergenic
1195799232 X:108688391-108688413 GCAGCCCCAGGTAAGACAATGGG - Intronic