ID: 931297269

View in Genome Browser
Species Human (GRCh38)
Location 2:60939732-60939754
Sequence TTGACTATGAAGGACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931297269 Original CRISPR TTGACTATGAAGGACACTGA TGG Intergenic
902946354 1:19842912-19842934 TTTACTATCAAGGACATTGTTGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
908502289 1:64756042-64756064 TTCACTGTAAAGGACATTGATGG - Intronic
910677996 1:89834045-89834067 TAGAGTAGGAGGGACACTGACGG + Intronic
912544783 1:110442903-110442925 TGGACTAGGATGGAAACTGAGGG + Intergenic
917441256 1:175071008-175071030 TAAACTATGAAGGAAAATGAGGG - Intronic
919039106 1:192359440-192359462 TTGAGTTTGAAGTATACTGAAGG - Intronic
923425860 1:233868912-233868934 TGGAGTATGAAGGGGACTGATGG - Intergenic
1064486268 10:15794120-15794142 CTGACCTAGAAGGACACTGAAGG - Intronic
1065458239 10:25930235-25930257 TTTACTAATAAGGAAACTGAAGG - Intergenic
1068912814 10:62396624-62396646 GTGACTATGAATGTCACTAATGG - Intronic
1070537412 10:77390076-77390098 TTGCTGATGAAGGACAGTGAAGG + Intronic
1071711643 10:88055622-88055644 TTGACTAATGAGGAAACTGAGGG + Intergenic
1072531137 10:96320726-96320748 ATCAGTATGAAGGACACAGAAGG + Exonic
1073351856 10:102825560-102825582 TTCATTTTGAAGGAAACTGAGGG - Intergenic
1073572320 10:104590978-104591000 TTGACTATGAAGGGTCATGAGGG - Intergenic
1073817115 10:107219955-107219977 TTGACTGGGAGGGAAACTGAGGG + Intergenic
1073906908 10:108292606-108292628 TTGACTATGAATGATTGTGAAGG - Intergenic
1075297101 10:121287226-121287248 TTGACTATCAAGGAGACAGGAGG - Intergenic
1077433133 11:2525962-2525984 TTGAGTATAAAGGACACAGTTGG + Intronic
1077487208 11:2844507-2844529 TTGCCTCCGACGGACACTGAAGG - Intronic
1078155262 11:8794564-8794586 TGGACTATGAAGGAAAATGAAGG + Intronic
1080447448 11:32350763-32350785 TTGACTAGGAACACCACTGAAGG - Intergenic
1080665271 11:34330345-34330367 TTTACAAAGAAGGAAACTGAGGG - Intronic
1081497601 11:43631179-43631201 TGGACTACAAAGGAGACTGAAGG + Intronic
1081611780 11:44567244-44567266 TGGACACTGAAGGACGCTGAAGG + Intronic
1082216826 11:49581320-49581342 TAGACTATGAATCATACTGAAGG - Intergenic
1083288011 11:61673321-61673343 TTGACTCTGAAGGGCACAAAGGG + Intergenic
1086074718 11:82837909-82837931 TTTACTGTGAAGGAAACTGAAGG - Intronic
1087966876 11:104425932-104425954 TTGTCTTTCAAGGACACTGTAGG - Intergenic
1089212102 11:116811537-116811559 TTGACTATGAATGTCACTGCAGG - Intergenic
1091992497 12:4967229-4967251 TTCAATCTGAAGGTCACTGAAGG - Intergenic
1093145340 12:15558398-15558420 TTGAGTATTAAGGACCCGGAAGG + Intronic
1094012372 12:25822854-25822876 TTGCCTACGAAACACACTGAAGG + Intergenic
1094419561 12:30256265-30256287 TTGTCAATGGAGGACACTGGAGG - Intergenic
1094559043 12:31532513-31532535 TTCACTATGGAGAACACAGATGG + Intronic
1095655961 12:44668964-44668986 GTGCCCATGAAGGCCACTGAGGG + Intronic
1097510601 12:60534487-60534509 TTGACTATGAAGAACCATGAAGG + Intergenic
1098877639 12:75883355-75883377 ATGACTATCAAGGAGACTGGGGG - Intergenic
1098881866 12:75925571-75925593 TTGACTGTCAAGGAGACAGAAGG - Intergenic
1100043472 12:90348749-90348771 TTAAGTATGAAGAAAACTGAAGG + Intergenic
1102771844 12:115484306-115484328 TTGCCCATAAAGGAAACTGAGGG + Intergenic
1104491602 12:129199222-129199244 CTAGCTATTAAGGACACTGATGG - Intronic
1107331157 13:39302319-39302341 GAGACCATGAAGGACACAGAAGG + Intergenic
1110037653 13:70708778-70708800 TTTACAGTGAAGGAAACTGAGGG - Intergenic
1111900686 13:94196055-94196077 TTGACTACAAAGAACATTGAGGG - Intronic
1115149538 14:30268657-30268679 TTGACTTTGAATCTCACTGAAGG - Intergenic
1116677276 14:47921933-47921955 CTGTCTGTGAAGGACACAGATGG - Intergenic
1117003524 14:51395399-51395421 TTGACTCTGAGGGGCACTGCTGG + Intergenic
1119531856 14:75367330-75367352 TTGACTCTGAAGGACATGGTGGG + Intergenic
1121063941 14:90943502-90943524 TTGGCTATGAAGGCACCTGAAGG - Intronic
1125467224 15:39965966-39965988 TTGACCAGGGAGGACAGTGAAGG + Intronic
1127711642 15:61604865-61604887 ATAACTGTGAAGGACAGTGAAGG - Intergenic
1128625111 15:69193356-69193378 CTGAATATGAAGGACAAAGAGGG - Intronic
1133643303 16:7738761-7738783 TTGACTAGGAAGGTAAATGAGGG + Intergenic
1134786030 16:16944536-16944558 TTTACTCTGAAGGACTCTGAAGG - Intergenic
1136134335 16:28245660-28245682 TTGGGTATGGAGGACCCTGAAGG - Intergenic
1137761885 16:50947860-50947882 TAGACTCTGAAGGGCACTGAAGG - Intergenic
1137949164 16:52766160-52766182 TTAAGTATTAAAGACACTGAAGG - Intergenic
1138979731 16:62253195-62253217 GTGACTATGAAGGATACAGTGGG + Intergenic
1139310239 16:66021900-66021922 AAAACTATGAAGGACACTGCTGG - Intergenic
1139406835 16:66725722-66725744 TTGGCTATTCAGGACACTGCAGG + Intronic
1140953801 16:79844240-79844262 TTGATTAGGAAAGAAACTGATGG + Intergenic
1141012486 16:80415901-80415923 GTGACTCTGAAGGACATAGAGGG - Intergenic
1146227052 17:31076154-31076176 AAGAGTATGAAGGACTCTGATGG + Intergenic
1148991616 17:51671262-51671284 TGGACTATGGAGAACCCTGAGGG - Intronic
1149058414 17:52391831-52391853 GTGACTATGAAGCACAGAGATGG + Intergenic
1150971969 17:70039042-70039064 TTAACTATGAAGGGGCCTGAGGG + Intergenic
1153298337 18:3570021-3570043 ATGACTATGCAGAACACTGTAGG - Intronic
1158008692 18:52703341-52703363 TAGACTCAGAAGGACAATGAAGG - Intronic
1162288203 19:9756808-9756830 TTGATTATGAAGTACTATGAAGG + Intronic
1164542509 19:29131438-29131460 TAGACTGTCAAGGAAACTGAGGG + Intergenic
1168056742 19:53868686-53868708 TGGACGAGGGAGGACACTGAGGG + Intronic
925991699 2:9259877-9259899 AGGACTATGCAGGACACTGCAGG - Intronic
926323491 2:11765206-11765228 TGGGCCATGATGGACACTGATGG + Intronic
926323522 2:11765316-11765338 TGGGCCATGATGGACACTGATGG + Intronic
926820899 2:16850756-16850778 TTTCCTATGAAGAACACTGAAGG - Intergenic
929387836 2:41432181-41432203 TTCTCTATGCAGGTCACTGAAGG + Intergenic
931297269 2:60939732-60939754 TTGACTATGAAGGACACTGATGG + Intergenic
932851711 2:75194126-75194148 TTGACCATTCAGGACACTGCAGG + Intronic
933950575 2:87326024-87326046 TTGACTTTCAAGGACACTCAGGG + Intergenic
934987644 2:98899507-98899529 TTGAGCCTGAAGGACAGTGAGGG + Intronic
936329205 2:111532555-111532577 TTGACTTTCAAGGACACTCAGGG - Intergenic
937400528 2:121579216-121579238 TTTACTATGAAGAAGACAGAGGG + Intronic
937993674 2:127677895-127677917 TTGACTAGGAAGGAATGTGAGGG + Intronic
939026091 2:137015294-137015316 TTGACTCTGAATTACTCTGATGG + Intronic
939393341 2:141597403-141597425 TTAACTGGGAAGGCCACTGAAGG - Intronic
941071734 2:160962587-160962609 TGGACAGTGAAGGACTCTGAAGG - Intergenic
947168253 2:227284424-227284446 TTGACAAATAAGGACAGTGAGGG + Intronic
948761989 2:240198059-240198081 TGGACTGTGATGGACAGTGATGG - Intergenic
948762061 2:240198449-240198471 TGGACTGTGATGGACAGTGATGG - Intergenic
1169070090 20:2721030-2721052 TTGATTATGATGTACATTGATGG + Intronic
1170343679 20:15358314-15358336 TTGAACATGAAGGAGACTTAGGG + Intronic
1173460748 20:43241414-43241436 TTGAGAATAAAGGACACTGCAGG - Intergenic
1173480745 20:43397242-43397264 TTGACTCTGGAGGTCACTGAAGG + Intergenic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
1180731153 22:17983518-17983540 CTGAGTCTGAAGGACACTGCCGG - Intronic
1182041377 22:27241378-27241400 TTGACAATGGAAGACTCTGAGGG - Intergenic
1184016125 22:41786916-41786938 TGGCCTATGAAGGATACTGGGGG + Intronic
949333555 3:2949003-2949025 CTGGCTATGTAGGACACTGCAGG - Intronic
949439358 3:4064008-4064030 TTGACAGAGAAGGAAACTGAGGG + Intronic
950249014 3:11448481-11448503 TAGACTATGGAGGAGACTAAAGG - Intronic
951252128 3:20406044-20406066 ATGACTATGGAGTACACTAAAGG + Intergenic
951373066 3:21876484-21876506 TTGACTAAGAATGACACTAAAGG + Intronic
951738105 3:25889937-25889959 TTGACTGTTAAGGATTCTGAAGG + Intergenic
956957140 3:74353922-74353944 TTGACTGTCAGGGACACAGAAGG - Intronic
960494742 3:118360752-118360774 TTGACTTTGGTGGAAACTGAAGG - Intergenic
963439745 3:145323255-145323277 TTGTTTATGAAGGTTACTGAAGG + Intergenic
964034335 3:152177720-152177742 CTGACTATGAAGGTCACTAGAGG - Intergenic
966416791 3:179697446-179697468 TAAGCTATGAAGGACAGTGAAGG - Intronic
968432995 4:569855-569877 ATGACTTTGAGGGGCACTGAAGG + Intergenic
968897297 4:3412217-3412239 CTGACCATGAGGGACACTGTTGG + Intronic
970888772 4:21018123-21018145 TTGTCTATGCAGGACCCTGGAGG - Intronic
973089739 4:46120404-46120426 TATACTATGAAGAACACTTATGG - Intronic
976359742 4:84163420-84163442 TTGTCTATGAAGAATACTTAGGG - Intergenic
978888099 4:113790184-113790206 AAGACTATGTAGGGCACTGAAGG - Intergenic
985287438 4:188350504-188350526 TTGACTACAAAGGCCAGTGAAGG + Intergenic
987424853 5:17761416-17761438 TTGACTATTAAGGCCGCTGCAGG - Intergenic
987559627 5:19502991-19503013 TTCACTCTGAAGGACAATGAAGG - Exonic
990550930 5:56877702-56877724 TTAGCTATGAAGGGCACTGTTGG - Intronic
991902597 5:71475409-71475431 TTGCTTATGAAGTGCACTGAAGG - Intronic
994991627 5:107004060-107004082 TTGACTATGAAGGAGAAAAATGG + Intergenic
995366889 5:111372086-111372108 TTGAATATGAAATAAACTGATGG + Intronic
995635204 5:114180769-114180791 TTGACTAGGAAGGGGGCTGAGGG - Intergenic
996586548 5:125094222-125094244 TTGAGTACCAAGAACACTGAGGG - Intergenic
1003497589 6:6677916-6677938 CAGACAATGAAGGACTCTGAGGG + Intergenic
1008065902 6:47047815-47047837 TTTACCATGAAGGTGACTGAGGG + Intergenic
1009305285 6:62082431-62082453 TTGAAGATGAAGGAAAATGATGG + Intronic
1010159273 6:72832575-72832597 TTGACTAAACAAGACACTGAAGG - Intronic
1010984951 6:82413107-82413129 TTGAAAATGAAGGAAGCTGAGGG + Intergenic
1013166709 6:107600604-107600626 AGGACTGTTAAGGACACTGATGG + Intronic
1013486830 6:110605296-110605318 TTGACTACAAATGACAATGAAGG + Intergenic
1015685723 6:135857285-135857307 ATGACTATGTAGAACACAGAAGG - Intronic
1017199214 6:151734335-151734357 ATGATTCTGAAGGTCACTGAAGG + Intronic
1021260338 7:18448631-18448653 TTGACCAAAAAGGAAACTGATGG - Intronic
1022853838 7:34296194-34296216 TTGGCTAAGAGGAACACTGAGGG + Intergenic
1023140153 7:37094073-37094095 CAGACTATGAGGGACACTGCAGG - Intronic
1023153745 7:37226950-37226972 TTTACTATGAAGTACACTGCGGG + Intronic
1023562010 7:41485196-41485218 TTGACAGTGGAGGACACTGTGGG - Intergenic
1024116829 7:46202215-46202237 ATGACTATGTTGGAGACTGAAGG + Intergenic
1026312603 7:69200255-69200277 TTGCCTATGGGGGACACTGCAGG - Intergenic
1027711786 7:81612982-81613004 TTCACATGGAAGGACACTGAGGG + Intergenic
1027747227 7:82092041-82092063 TTGTCTATGTAAGACACTTAGGG - Intronic
1031445401 7:121847311-121847333 TTGACTTTGAATGAAACAGATGG - Intergenic
1033352135 7:140570223-140570245 GTGACTGTCAAGGACACTAAAGG + Intronic
1036950788 8:13137202-13137224 ATGAAGAGGAAGGACACTGAGGG - Intronic
1039307375 8:36277452-36277474 TTGACTGCAAAGGACACAGAGGG - Intergenic
1040681123 8:49810853-49810875 TTGACTATGAAGTTCACTTTTGG - Intergenic
1041019952 8:53628475-53628497 TTGTCTAGGAAGGACACAGGAGG - Intergenic
1042391270 8:68238397-68238419 GTGACTTTGGAGGACAATGATGG + Intergenic
1046209433 8:111048551-111048573 ATGAATATTAAGTACACTGATGG + Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1052460708 9:28759327-28759349 TTGAAAATGAAGGACAAAGAGGG + Intergenic
1057093421 9:92281988-92282010 TTAACTATAAAGGACACTGCTGG + Intronic
1059512105 9:114858336-114858358 TTGGCAAGGAAGGACACTGATGG + Intergenic
1059599921 9:115765871-115765893 TTCATTATGAAGCACACTGTGGG - Intergenic
1059850134 9:118328992-118329014 TTGACTCTGAAGCACAGTGCTGG - Intergenic
1186130853 X:6463777-6463799 TTGACTTTGAAGGCTACTGAAGG - Intergenic
1186558159 X:10582726-10582748 GGGACTATGAAGGACATTAAGGG - Intronic
1187661656 X:21553491-21553513 TTGACAATGTAGGACCCTAATGG - Intronic
1188875789 X:35428637-35428659 TTGACTATTGATGACACTCAAGG - Intergenic
1189728910 X:43998040-43998062 TTAATAATGAAGGACAGTGACGG - Intergenic
1192283198 X:69705745-69705767 ATGACTAAAATGGACACTGATGG - Intronic
1193149975 X:78114901-78114923 TTGACTAGAAAGGAAGCTGAAGG + Intronic
1196989959 X:121317418-121317440 CTGAAAATGAAGGACACTTATGG + Intergenic
1199975134 X:152890317-152890339 TTGATGATGAAGAAAACTGAGGG + Intergenic