ID: 931308515

View in Genome Browser
Species Human (GRCh38)
Location 2:61056143-61056165
Sequence CTGGGGGCTCTCTGTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931308509_931308515 23 Left 931308509 2:61056097-61056119 CCGTATCATCTCATTTCATTACA No data
Right 931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG No data
931308510_931308515 -2 Left 931308510 2:61056122-61056144 CCAAGTTCTATAAGCATGAAACT No data
Right 931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931308515 Original CRISPR CTGGGGGCTCTCTGTTTTGT TGG Intergenic
No off target data available for this crispr