ID: 931316417

View in Genome Browser
Species Human (GRCh38)
Location 2:61136795-61136817
Sequence TTTTATTTTTAGTAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95048
Summary {0: 1, 1: 0, 2: 200, 3: 6309, 4: 88538}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931316417_931316420 -10 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316420 2:61136808-61136830 AAAAATAAAAAAAATTAGCCAGG 0: 836
1: 65202
2: 74513
3: 97787
4: 208693
931316417_931316422 2 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316422 2:61136820-61136842 AATTAGCCAGGCGTGATGGCAGG 0: 379
1: 13057
2: 47707
3: 77915
4: 70617
931316417_931316421 -2 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316421 2:61136816-61136838 AAAAAATTAGCCAGGCGTGATGG 0: 480
1: 18140
2: 83417
3: 170780
4: 198419
931316417_931316424 25 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316424 2:61136843-61136865 TGCCTGTAATCCCAGCTACTTGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
931316417_931316427 29 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316427 2:61136847-61136869 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
931316417_931316425 26 Left 931316417 2:61136795-61136817 CCCTGCACCTACTAAAAATAAAA 0: 1
1: 0
2: 200
3: 6309
4: 88538
Right 931316425 2:61136844-61136866 GCCTGTAATCCCAGCTACTTGGG 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931316417 Original CRISPR TTTTATTTTTAGTAGGTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr