ID: 931321553

View in Genome Browser
Species Human (GRCh38)
Location 2:61177968-61177990
Sequence CTGTGTTAGGGGCGGGGGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931321536_931321553 27 Left 931321536 2:61177918-61177940 CCCACCCCTCTGGATGTTTCGGG 0: 1
1: 0
2: 1
3: 3
4: 70
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372
931321538_931321553 26 Left 931321538 2:61177919-61177941 CCACCCCTCTGGATGTTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372
931321542_931321553 21 Left 931321542 2:61177924-61177946 CCTCTGGATGTTTCGGGGAGTTA 0: 1
1: 0
2: 1
3: 5
4: 54
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372
931321534_931321553 30 Left 931321534 2:61177915-61177937 CCGCCCACCCCTCTGGATGTTTC 0: 1
1: 0
2: 3
3: 34
4: 681
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372
931321540_931321553 23 Left 931321540 2:61177922-61177944 CCCCTCTGGATGTTTCGGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372
931321541_931321553 22 Left 931321541 2:61177923-61177945 CCCTCTGGATGTTTCGGGGAGTT 0: 1
1: 1
2: 0
3: 5
4: 82
Right 931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG 0: 1
1: 1
2: 1
3: 33
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931321553 Original CRISPR CTGTGTTAGGGGCGGGGGTA TGG Exonic
900166494 1:1246162-1246184 CTGATTTGGGGGCGGGGGTGGGG - Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
901807524 1:11747875-11747897 CTCTTTTAGGGGAGGGGATATGG + Intronic
901959753 1:12816261-12816283 CTGTGGTGGGGTCGGGGGGAGGG - Intergenic
902338486 1:15767541-15767563 CTGTGGTGGGGGCGGGGGCGGGG - Exonic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903183880 1:21618887-21618909 GTGTGCCAGGTGCGGGGGTAGGG - Intronic
904117820 1:28175441-28175463 GTGTGTTGGGGGAGGCGGTAGGG - Intronic
904329528 1:29749195-29749217 CTGTGTTTGTGGTGGGGGCAGGG - Intergenic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
905874692 1:41424257-41424279 CTGAGTGAGTGGCGGGGGTGTGG + Intergenic
908160872 1:61407286-61407308 TTGGGGTAGGGGCTGGGGTACGG + Intronic
908346625 1:63239877-63239899 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
911559610 1:99388686-99388708 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
913261383 1:117000991-117001013 CTGTCATAGGGTCGGGGGAAGGG + Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915743996 1:158142152-158142174 CTATGGCAGGGGCGGGGGCAGGG + Intergenic
915920388 1:159971919-159971941 GTGTTTTGGTGGCGGGGGTAAGG - Intergenic
916210042 1:162353031-162353053 CTGTGGTGGGGGCGGGGGTGGGG - Intronic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
918433220 1:184483903-184483925 GTGTGTGTGGGGCGGGGGTGGGG + Intronic
919918558 1:202154113-202154135 CTGTGTGTGGGGTGGGGGTGGGG + Intronic
920288174 1:204896887-204896909 CTGCGCTAGGGGCTGGGATAGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
923041791 1:230324927-230324949 GTGTGTTAGGGGTGTGGGGAAGG + Intronic
923418693 1:233790939-233790961 CTGGGGTGGGGGTGGGGGTATGG - Intergenic
923663311 1:235977622-235977644 CTGTCTGAGGGTTGGGGGTAGGG + Exonic
924593942 1:245428971-245428993 CTGTGGTGGGGGCGGGGGTGGGG + Intronic
1063532225 10:6844709-6844731 TTTTGTTGGGGGTGGGGGTAAGG - Intergenic
1066653896 10:37682064-37682086 CTGTTTTAGAGGCGTGGGTGGGG - Intergenic
1067581061 10:47446339-47446361 CTGAGTCAGGGTCGGGGGTATGG + Intergenic
1067832597 10:49618989-49619011 GGGTGTTAGGGGCAGGGGTGGGG - Intronic
1068251888 10:54453504-54453526 TGGGGTTAGGGGAGGGGGTAGGG + Intronic
1068313991 10:55318254-55318276 ATGTGTTGGGGGCAGGGGTGTGG + Intronic
1069858709 10:71456649-71456671 CTGTGCTGGGGGGTGGGGTAGGG + Intronic
1071124830 10:82321289-82321311 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
1071531530 10:86393117-86393139 TTTTGTTGGGGGTGGGGGTACGG + Intergenic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073345081 10:102776836-102776858 CTGTGTTGGGGGTGGGGTGAGGG + Intronic
1073428607 10:103471504-103471526 GGGTGTTGGGGGTGGGGGTAGGG + Intergenic
1074043184 10:109812573-109812595 CTGTGGTGGGGTCGGGGGGAGGG - Intergenic
1074107414 10:110398828-110398850 GTGTGTTGGGGGGTGGGGTAAGG - Intergenic
1074109804 10:110414826-110414848 CCTTGTTAGGGGTGGGGGTGAGG - Intergenic
1076897011 10:133317876-133317898 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897119 10:133318272-133318294 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1077787895 11:5404139-5404161 CTGGGTCGGGGGCGGGGGGAGGG + Intronic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078754109 11:14192726-14192748 CTGTGATGGGGGCGGGGGGTGGG - Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1081605489 11:44524825-44524847 GTGTGTCGGGGGCGGGGGTTGGG + Intergenic
1082824128 11:57565917-57565939 ATATGTTGGGGGTGGGGGTAAGG - Intronic
1082910212 11:58363964-58363986 CTGTTGTGGGGGTGGGGGTAGGG + Intergenic
1082943949 11:58738909-58738931 GTGTGTGGGGGGGGGGGGTAGGG - Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1085084920 11:73660676-73660698 CTGTGCCAGGCGTGGGGGTAGGG + Intronic
1086542112 11:87925393-87925415 CTGTGTTAGGGTTAGGGTTAGGG + Intergenic
1087183390 11:95160822-95160844 GTGTGTTGGGGGCGGGGGATGGG - Intergenic
1089318990 11:117612440-117612462 GTGTGTTAGGGGCGGGGGTAGGG - Intronic
1089567762 11:119381075-119381097 GGGGGTTAGGGGCGGGGGTTGGG - Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089946379 11:122478383-122478405 CTGTGGTGGGGTCGGGGGGAGGG + Intergenic
1090078529 11:123594712-123594734 CTGTGGTAGGAGCGGAGGTAGGG - Intronic
1090496226 11:127215340-127215362 CAGTCTTAGAGGCTGGGGTAGGG + Intergenic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1091773946 12:3172211-3172233 CTGGGGTGGGGGCGGGGGAAGGG - Intronic
1091824323 12:3499344-3499366 CTGTGGTGGGGTCGGGGGGAGGG - Intronic
1092214596 12:6672280-6672302 GTGTGTCCGGGGCGGGGGTGGGG + Intronic
1095074381 12:37898382-37898404 GTGGGTTGGGGGAGGGGGTAGGG + Intergenic
1095739392 12:45590519-45590541 CTGTGATAGGGGTGAGGGTGAGG - Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1098922151 12:76312615-76312637 ATGTGTGAGCGGCGGGGGTGGGG + Intergenic
1100105350 12:91164210-91164232 CTGTGGTGGGGTCGGGGGAAGGG + Intronic
1100200962 12:92297390-92297412 CTGGGTTAGGATCTGGGGTAGGG - Intergenic
1100542054 12:95566961-95566983 CTGTGTGTGGGGCGGGGGAGAGG - Intergenic
1101231190 12:102743246-102743268 CTGTGGTAGGGTGGGGGGAAGGG - Intergenic
1101518554 12:105460204-105460226 CTGTGTCTGCGGCGGGGGTGGGG + Intergenic
1101625347 12:106435249-106435271 CTGGGTCAGGGACGGGGGTGGGG - Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102298661 12:111756085-111756107 CTGTGCTGGGGCCGGGGGTTAGG - Intronic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1103373853 12:120439881-120439903 CTGTGATGGGGGCGGGGGAGGGG - Intronic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1106656829 13:31755461-31755483 GTGTGTTGGGAGCGTGGGTACGG + Intronic
1107414688 13:40189909-40189931 CTGGGGTAGGGGTGGGGGTGAGG - Intergenic
1107975136 13:45680955-45680977 CTGAGATTGGGGCGGGGGTGGGG + Intergenic
1107985011 13:45767979-45768001 GTGTGGTGGGGGCGGGGGGAGGG + Intergenic
1112854792 13:103754509-103754531 GTGGGTGAGGGGCGGGGGGAGGG + Intergenic
1115347454 14:32358515-32358537 CTGTGTTGGGTGGGGGGGTTAGG + Intronic
1116121656 14:40728851-40728873 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
1116778857 14:49213235-49213257 CTGCCTGAGGGGCGGGGGTGGGG - Intergenic
1117156279 14:52945254-52945276 GTGGGTTGGGGGCGGGGGGACGG + Intronic
1118326676 14:64786102-64786124 CTGGGGTAGGGGTGGGGGCAAGG - Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1119205711 14:72792085-72792107 CGGGGTTGGGGGCGGGGGTGGGG - Intronic
1119773575 14:77235856-77235878 CTGTGGTGGGTGGGGGGGTATGG + Intronic
1121315547 14:92959118-92959140 ATCTGGTAGGGGCTGGGGTAGGG + Intronic
1122411539 14:101528435-101528457 CTGAGTTGGGGGTTGGGGTATGG + Intergenic
1122631621 14:103109856-103109878 CTGTGCTGGGGGAGGGGGCAGGG - Intronic
1122663156 14:103311289-103311311 GTGTGTTGGGGACGGGGGTGTGG + Intergenic
1122985382 14:105209377-105209399 CTGAGCTCTGGGCGGGGGTAGGG + Exonic
1124949146 15:34300465-34300487 CTGTGTTATGGCTAGGGGTAGGG - Intronic
1125508296 15:40279949-40279971 CGGGGTTGGGGGCGGGGGTCCGG - Intronic
1126476917 15:49074933-49074955 CTGTGGGAGGTGAGGGGGTAGGG + Intergenic
1126713225 15:51484144-51484166 GTCTGTTAGGGGTGGGGATAAGG - Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128738857 15:70069817-70069839 CTGTGATAGGGACGGGGGTCAGG - Intronic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1129733352 15:77944388-77944410 CCGAGACAGGGGCGGGGGTACGG - Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1131022354 15:89109458-89109480 CTGGGTTTGGGGTGGGGGTAGGG + Intronic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131091032 15:89625183-89625205 CTGTGGGAGAGGCGGGGGCAGGG - Exonic
1131920444 15:97321943-97321965 CTGTGCCAGGGACGGAGGTAGGG - Intergenic
1132678139 16:1129149-1129171 CTGTTTGCGGGGCGGGGGTGAGG + Intergenic
1132946036 16:2531926-2531948 CTGCGTTTGGGGCGTGGGCACGG + Intergenic
1135617988 16:23928582-23928604 CTGAGCTAGGAGCTGGGGTAAGG + Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136110162 16:28059593-28059615 CTGGGTTAGGGGCGATGGTGGGG - Intronic
1136390539 16:29961743-29961765 CTGTGCTATTGGCGCGGGTAGGG + Intronic
1136487888 16:30585066-30585088 GTGAGTTGGGGGCGGGGGTTGGG + Intronic
1136691268 16:32032553-32032575 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1136791856 16:32976118-32976140 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1136877961 16:33877790-33877812 CTGTCTCAGGAGCGGGGGTGAGG + Intergenic
1137246248 16:46707996-46708018 CTTTTTTTGGGGAGGGGGTAGGG + Intronic
1138741239 16:59313099-59313121 GTGTGTATGGGGTGGGGGTAGGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140409047 16:74730300-74730322 CTGTGGCAGGGGTGGGGGTTGGG + Intronic
1141697832 16:85628424-85628446 CTTTGTCAGAGGCCGGGGTAGGG + Intronic
1141720360 16:85752201-85752223 CTTTGTTAGAGGCGGGGGAGTGG - Intergenic
1142125021 16:88405903-88405925 GTGTTTTGGGGGCGGGGGTCGGG - Intergenic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1203094068 16_KI270728v1_random:1237582-1237604 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1142476165 17:191609-191631 CTGTCGCAGGGGCGGGGGAACGG - Intergenic
1143136799 17:4716655-4716677 CTGTGTCTGGGGTGGGGGTAAGG + Exonic
1143653192 17:8277070-8277092 CTGTCTCAGGGGTGGGGGTGGGG + Intergenic
1143803879 17:9409080-9409102 CTCTGGTGGGGGCGGGGGCAGGG - Intronic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1145194327 17:20875428-20875450 CTGTTTTATGGCCTGGGGTATGG + Intronic
1146300587 17:31686095-31686117 CTGAGTTATGGGTGGGGGTGAGG - Intergenic
1146619957 17:34389477-34389499 CTGGCTGAGGGGTGGGGGTAAGG + Intergenic
1147240468 17:39087346-39087368 CTGGGTTTGGGGTGGGGGTTAGG - Intronic
1147378232 17:40035704-40035726 CTGAGGTAAGGGCAGGGGTAAGG - Exonic
1147576128 17:41600077-41600099 CTGGGTTTGGGGTGGGGGCAGGG - Intergenic
1147608044 17:41785454-41785476 CTGAGGTAGGGGCCGGGGTGGGG - Intronic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148489030 17:48011669-48011691 GTGTGTTAGGGACGGGAGAAGGG - Intergenic
1149376549 17:56049538-56049560 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
1149841242 17:59966313-59966335 TTTTGTTGGGGGTGGGGGTAGGG + Intronic
1150074219 17:62179031-62179053 CTGTGGTATTGGCGGGGGCAAGG - Intergenic
1150790132 17:68196531-68196553 TGGGGTTAGGGGTGGGGGTAGGG + Intergenic
1152007559 17:77691987-77692009 CGGGGGTAGGGACGGGGGTAGGG - Intergenic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152789732 17:82272874-82272896 CCGTGGGAGGGGAGGGGGTAGGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155548473 18:26939932-26939954 CTCTGCTTGGGGAGGGGGTATGG - Intronic
1156385385 18:36599953-36599975 CAGTGTTTGGGGTGGGGGTGGGG + Intronic
1157588772 18:48822489-48822511 GTGTGTTGGGGGTGGGGGTGGGG - Intronic
1158662768 18:59404087-59404109 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
1158883469 18:61803654-61803676 GTGTGTTGGGGGTGGGGGTGGGG - Intergenic
1158977384 18:62723666-62723688 GTGTGTTGGGGGTGGGGGTTGGG + Intronic
1160427499 18:78788157-78788179 CTTTGTGGGGGGCGGGGGTCGGG - Intergenic
1161253796 19:3295213-3295235 CTGGGGCAGGGGCGGGGGTGGGG + Intronic
1161310778 19:3592949-3592971 CTTTGCTAGGGGCTGGGGTGGGG - Exonic
1161849351 19:6730747-6730769 CTGAGCTAGGGGTGGGGTTAGGG - Intronic
1162392172 19:10396247-10396269 TTGGGTATGGGGCGGGGGTAAGG - Intronic
1162528902 19:11224051-11224073 GTGTGTGTGGGGCGGGGGCAGGG + Intronic
1162762612 19:12897438-12897460 GTGTGGTGGGGGCGGGGGGATGG + Intronic
1162973874 19:14197350-14197372 AGGTGTTGGGGGCGGGGGCAGGG - Intronic
1163497852 19:17657020-17657042 CTGGGTTGGGGCCCGGGGTACGG - Intronic
1163721290 19:18899368-18899390 CTGTGTGAGGGGCGGGGTGGGGG + Intergenic
1163727906 19:18932881-18932903 GCGTGGCAGGGGCGGGGGTAGGG - Intronic
1164229636 19:23276004-23276026 CTGTGGTAGGGCTGGGGGTTGGG + Intergenic
1164667321 19:30050161-30050183 CTGTGTTGGGGGTGGGGGTAGGG + Intergenic
1164973124 19:32549412-32549434 CTTTTTTGGGGGCGGGGGTGGGG + Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1166089325 19:40497948-40497970 CTGGGTTTGGGGCTGGGGTAGGG - Intronic
1166760462 19:45221025-45221047 CTGAGACAGGGGCGGGGGGAGGG + Intronic
1167137483 19:47625850-47625872 CTGTGTGGGGGCCGGGGGCACGG + Intronic
1167230391 19:48279437-48279459 CTGTGTGGGGGGCGGGGGTGGGG + Intronic
1167312780 19:48746757-48746779 TTGTGTTGGGGACGAGGGTAAGG + Exonic
1167490439 19:49789928-49789950 CTGTGCTAGGAGCTGGGTTATGG + Intronic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
926313961 2:11696180-11696202 CTTGTTTGGGGGCGGGGGTAAGG - Intronic
926444679 2:12927642-12927664 CTGTGGTGGGGTCGGGGGAAGGG + Intergenic
926792930 2:16593874-16593896 CTGTGGTGGGGTCGGGGGTCGGG - Intronic
928299138 2:30110226-30110248 CTGGGGTAGGGGCTGGGGTATGG - Intergenic
929367449 2:41177193-41177215 CTGTGTGGGGGGTGGGGGTAGGG - Intergenic
929561588 2:42959690-42959712 CTGGGTTAGGGGTGGGCGTGGGG + Intergenic
929834401 2:45381513-45381535 CTGTGTTGGTGGTGGTGGTAGGG + Intergenic
930596932 2:53400670-53400692 CTGTGGTGGGGTCGGGGGGAGGG + Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931015758 2:57978799-57978821 CTGTTGTAGGGTCGGGGGTGAGG - Intronic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931927009 2:67084649-67084671 GTGTGTTGGGGGCTGGGGAATGG + Intergenic
932891454 2:75600462-75600484 CTGTCTTAGGGTTGGGGGTATGG + Intergenic
933673900 2:85036003-85036025 CTTAGTAAGGGGCAGGGGTAGGG + Intronic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
934919876 2:98334198-98334220 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
935050051 2:99517729-99517751 CTGTGTTAGGGAGGAGGGCATGG + Intergenic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
936020124 2:108988448-108988470 CTGTGTTGGTGGCGGGGGAGCGG - Intronic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
936983099 2:118282363-118282385 CAATGTTGGGGGCGGGGGGATGG + Intergenic
939253823 2:139717642-139717664 GTGTGTTGGGGGTGGGGATAGGG + Intergenic
939549736 2:143599524-143599546 CTGTGTAGATGGCGGGGGTAGGG - Intronic
939948600 2:148441252-148441274 CTGTGGTGGTGTCGGGGGTAGGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941013512 2:160328653-160328675 TGGTGTTGGGGGCGGGGGGAGGG - Intronic
941722795 2:168829736-168829758 CTCTGATAGGGGTGGGGTTATGG + Intronic
941840406 2:170076856-170076878 CTATGGTAGGGGTGGTGGTAGGG + Intronic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
942482840 2:176407485-176407507 CTGGGGGAGGGGCGGGGGTGTGG - Intergenic
942520089 2:176794676-176794698 ATGTGATAGGGGCTGGGGCAGGG - Intergenic
942609534 2:177728370-177728392 CAGGGTTGGGGGCGGGGGGAGGG + Intronic
942633722 2:177978920-177978942 CTGTGGTGGGGTCGGGGGGAGGG + Intronic
943177553 2:184496506-184496528 GTCTGTTAGGGGCTGGGGGAGGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946099945 2:217311618-217311640 CTGTGGTGGGGTCGGGGGAAGGG + Intronic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
948181840 2:235988457-235988479 CTGACTTCGGGGCGGGGGTTGGG - Intronic
1169194503 20:3675909-3675931 GTGTGTGTGGGGCAGGGGTAGGG - Intronic
1172157373 20:32837402-32837424 CAGAGTCAGGGGCGGGGGTAGGG + Intronic
1172624905 20:36341406-36341428 CTTTGCTAGGGGCTGGGGTTGGG - Intronic
1173040996 20:39462438-39462460 ATGGGATAGGGGTGGGGGTAAGG - Intergenic
1176743014 21:10623176-10623198 CTGTGTTTGTAGCGGGGGTGGGG + Intergenic
1176987698 21:15456310-15456332 CAGGGTTGGGGGCGGGGGTGTGG - Intergenic
1179788604 21:43743206-43743228 CAGTGCTGGGGGCGGGGGGAGGG - Intronic
1180172380 21:46066337-46066359 CTGTGTTGGGGGCCGGGGGAAGG + Intergenic
1181592809 22:23895298-23895320 CGGTGTTGGGGGCGGGGGTCAGG + Exonic
1183353867 22:37348397-37348419 CTGTGTTAGGGGGCAGGGAAGGG + Intergenic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1184651935 22:45923396-45923418 CTGGGCTAGAGGCAGGGGTAGGG - Intronic
1184685988 22:46096611-46096633 CTGGGTCAGGGACGGGGGTAGGG - Intronic
1184958946 22:47914803-47914825 GTGTGTTGGGGGCGGGGGGTGGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
951628516 3:24693270-24693292 CTGTCTGGGGGGTGGGGGTAAGG - Intergenic
952078665 3:29730296-29730318 CTGTGTTCTGGGCGGGGGGCGGG + Intronic
952748129 3:36801292-36801314 GTGTGTCAGGGTTGGGGGTAAGG + Intergenic
954941276 3:54375433-54375455 CTTTGTTAGGGGGTGGGGTGGGG + Intronic
954962117 3:54575872-54575894 CCTTCTTAGGGGCTGGGGTAGGG - Intronic
956121352 3:65969341-65969363 CTGTGTTAGGGGCTGGGGGGTGG + Intronic
958013861 3:87914948-87914970 CTGTTTTAGTGGAGGTGGTAGGG - Intergenic
960266335 3:115624890-115624912 CTGTGGTGGGGGTGGGGGTGTGG + Intronic
960452801 3:117831182-117831204 CTGTGATAGGTGCTCGGGTAAGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960737618 3:120797996-120798018 TTGTGTTAGGGGCTGGGTTAAGG - Intergenic
961090357 3:124105856-124105878 ATGTGTTTGAGGCTGGGGTAAGG + Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961674496 3:128556174-128556196 CTGGGGCAGGGGCTGGGGTAGGG - Intergenic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962627729 3:137243402-137243424 GTGTTTTAGGGGAGGGGGTGCGG - Intergenic
963049295 3:141127927-141127949 CTGTGGGAGGGGCAGGGCTAAGG - Intronic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
964483576 3:157164753-157164775 GTGTGTTGGGGGTGGGGGTGGGG - Intergenic
964570569 3:158105035-158105057 GTGTGTTGGGGGCGGGGGGGGGG - Intronic
964923815 3:161931953-161931975 CTGTTGTAGGGTCGGGGGAAGGG - Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
966593949 3:181710607-181710629 ATGAGATGGGGGCGGGGGTAGGG - Intergenic
967266575 3:187697144-187697166 CTGTCTTAGCGGCGGGGGTGGGG - Intergenic
967291647 3:187926684-187926706 CAGTGATAGGGGTGGGGGAAAGG - Intergenic
968190233 3:196661867-196661889 CGGTGGTGGGGGCGGGGGTGGGG - Exonic
968457054 4:705390-705412 CGGTGTTAGGGTCAGGGGTCGGG - Intergenic
968568305 4:1326620-1326642 CTGAGGCAGGGGCGGGGGTGGGG - Intronic
969568760 4:7995793-7995815 ATGTGAGAGGGGCGGGGGTCGGG + Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
971511371 4:27429499-27429521 CAGTCTGAGGGGCGGGGGAAGGG - Intergenic
972437688 4:39049574-39049596 CTTCCTTGGGGGCGGGGGTAGGG + Intronic
973085641 4:46055947-46055969 CTGTGGTGGGGTCGGGGGGAGGG + Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
975728441 4:77315214-77315236 CTGTGGTGGGGTCGGGGGTGGGG + Intronic
976408548 4:84686646-84686668 CTGTGGTAGGGGTGAGGGTAAGG + Intronic
976663483 4:87564972-87564994 CTGTGGTGGGGTCGGGGGGAGGG + Intergenic
977471770 4:97452126-97452148 CTGTGCTGGGGGCGGGGGGGGGG - Intronic
978098001 4:104803268-104803290 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
978189926 4:105898878-105898900 GAGTGCTTGGGGCGGGGGTAGGG + Intronic
978474407 4:109109701-109109723 CAGTGTTAGGTGTGGGGTTAAGG - Intronic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
981863833 4:149389707-149389729 GTGGGTTGGGGGCGGGGGGAGGG + Intergenic
983066714 4:163218736-163218758 CTTTTTTTGGGGCGGGGGGAGGG + Intergenic
983353375 4:166623149-166623171 CAGTGTTGGGGGCGGGGTCATGG - Intergenic
984779061 4:183506779-183506801 CCGTGTTTGGGGAGGGGGTGGGG + Intronic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
995265715 5:110157140-110157162 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
995477354 5:112561751-112561773 CTGGGTTAGGGTCAGGGGTGTGG - Intergenic
995603937 5:113830478-113830500 CTGTGTTTGGGCAGGGGGTGAGG + Intergenic
996626045 5:125571401-125571423 CTGTGGTGGGGTCGGGGGAAGGG + Intergenic
996685674 5:126278198-126278220 CTGTTTTGGGGGTTGGGGTAGGG - Intergenic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999400020 5:151257408-151257430 CTGGGCTGGGGGTGGGGGTAGGG - Intronic
999673897 5:153980321-153980343 CTATGTTAGGGGCTTGGGCAGGG + Intergenic
999897627 5:156052262-156052284 CTGTCTCAGTGTCGGGGGTAAGG + Intronic
1000021325 5:157321732-157321754 CTGTGCTGGGGGCTGGGGCAGGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001377479 5:171275808-171275830 TTGTGTGAGGGGTGGGGGTAGGG - Intronic
1001426371 5:171625373-171625395 ATGTGGTGGGGGAGGGGGTAGGG - Intergenic
1001958712 5:175866660-175866682 CTGAGTTAGGGGCAGGGCTTTGG + Intronic
1002394955 5:178945520-178945542 CTGTGTGGGGGGTGTGGGTATGG + Intronic
1003058029 6:2840866-2840888 CTGGGGGTGGGGCGGGGGTAAGG + Intronic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004562565 6:16763338-16763360 GGGTGTTGGGGGCGGGGGTGAGG - Intergenic
1006249504 6:32769622-32769644 CTGAGTTGGGGGCGAGGGTGGGG - Intergenic
1006812004 6:36826164-36826186 ATGTGTTATGGGCGGTGGGAGGG + Intronic
1007731821 6:43951987-43952009 TTGTGTGTGGGGTGGGGGTATGG + Intergenic
1011054830 6:83193593-83193615 CTTGGCTAGGGGCGGGGGTGGGG + Intronic
1012637186 6:101558566-101558588 ATGTGGTAGGGGTGGGTGTATGG + Intronic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013349401 6:109291762-109291784 GTGTATTAGGGGTGGGGGTTGGG + Intergenic
1014296259 6:119621217-119621239 GTGTGTTTGGGGCTGGGGTAGGG - Intergenic
1015847146 6:137532497-137532519 GTGTGTGTGTGGCGGGGGTAGGG + Intergenic
1017694900 6:157004728-157004750 CGGTGTTAGGGGAGGGTGTTGGG + Intronic
1018109114 6:160518327-160518349 GTGTGTTTGGGGCGGTGGTAGGG + Intergenic
1018134846 6:160769231-160769253 GTGTGTTTGGGGCAGTGGTAGGG - Intergenic
1019437788 7:1030854-1030876 CTGTGTTGGGGCCCGGGGTGTGG - Intronic
1020510494 7:9050211-9050233 CTGTAATAGTGGCAGGGGTAGGG - Intergenic
1021586844 7:22218107-22218129 CTGGGTGAGAGGAGGGGGTAGGG - Intronic
1022837361 7:34130890-34130912 CTGTCTTAGGGGAGAGGGTGAGG + Intronic
1023826760 7:44014953-44014975 GTGTGTGTGTGGCGGGGGTAGGG - Intergenic
1024000851 7:45188715-45188737 CTGGGTTGGGGGCGGGGGGGTGG - Intergenic
1025115465 7:56254518-56254540 CTGTGCCAGGGGCGGGGCTGTGG - Intergenic
1026119565 7:67524967-67524989 GTGTGTTAGAGGTGAGGGTAAGG + Intergenic
1026199854 7:68205388-68205410 CTGTGTCAGGGGTGGGGCTGTGG - Intergenic
1026830529 7:73607421-73607443 CTGGGGTAGGGGCCGGGGGAGGG + Intronic
1026869592 7:73842258-73842280 CTGGGATAGGGGCCGGGATAGGG - Intronic
1026945909 7:74316031-74316053 CTGTTGTGGGGGCGGGGGGAGGG - Intronic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1031968324 7:128044629-128044651 CTGTGTGTGTGGCGGGGGTGGGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032454553 7:132063611-132063633 GTGTGTTAGGGGTGGGGATTGGG + Intergenic
1033655385 7:143370131-143370153 CTGTGTTGGGGGCAGGGCCAAGG + Intergenic
1034376460 7:150649127-150649149 GTGTCTTAGGGGTGGGGGCAGGG + Intergenic
1034894851 7:154869849-154869871 GTGTGTTGGGGGCAGGGGTGGGG - Intronic
1034994796 7:155570902-155570924 CAGGTTTAGGGGCGGGGGTGGGG - Intergenic
1035017762 7:155781569-155781591 CTCTGTAAGGGGCCGGGGTCGGG + Intergenic
1036200079 8:6763479-6763501 CTGTGTTAGGCGCTGTGCTAGGG + Intergenic
1036698691 8:10996624-10996646 ATATGTGAGGGGCAGGGGTAAGG + Intronic
1036753347 8:11456809-11456831 CTGGGTTAGGGACGTGGGTGGGG + Intronic
1037121579 8:15294121-15294143 GTGTGTTGGGGGTGGGGGTGGGG + Intergenic
1037783263 8:21885921-21885943 CTGTGCTAGGGTCGGGGGAGGGG - Intergenic
1038441622 8:27574603-27574625 GTGGGGTAGGGGCGGGAGTAGGG + Intergenic
1038664956 8:29529968-29529990 CTGGCTTAGGGGCGGGGTTGGGG - Intergenic
1039454841 8:37699509-37699531 GGGTGTTAGGGGCGGGAGTCTGG - Exonic
1041276727 8:56167391-56167413 CTTTGTTAGGGTCGTGTGTATGG + Exonic
1042053690 8:64739112-64739134 CTGTGCCTGGGGCGGGGGTAAGG - Intronic
1042638068 8:70900806-70900828 CTGTAGTGGGGTCGGGGGTAGGG - Intergenic
1042654315 8:71079092-71079114 AAGTGTTAGGGGTGGGGGTGGGG - Intergenic
1042763616 8:72297114-72297136 CTGTCATGGGGTCGGGGGTAGGG + Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043817262 8:84816626-84816648 CTGGGGCAGGGGCGGGGGTATGG + Intronic
1045035882 8:98176227-98176249 CTGTGGTGGGGGTGGGGGTCGGG + Intergenic
1047024392 8:120811127-120811149 GTGTGTTGGGGGGGGGGGAAGGG - Intronic
1047478656 8:125259512-125259534 GTGTGGTGGGGGCAGGGGTAGGG - Intronic
1047837237 8:128707589-128707611 CTGTGGTGGGGTCGGGGGTGGGG - Intergenic
1048502868 8:134994516-134994538 CTGTGGAAGGGGCGGGGGTGCGG + Intergenic
1049525652 8:143125565-143125587 ATGTGTCAGGGACGGGGGTGGGG + Intergenic
1050281160 9:4051303-4051325 GTGTGGCAGGGGCGGGGATAGGG + Intronic
1052133726 9:24884313-24884335 CTGTTGTAGGGTCGGGGGTGTGG - Intergenic
1054982136 9:71219187-71219209 GTGTGTTGGGGGTGGGGGTTGGG + Intronic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1058651161 9:107176816-107176838 GTGTGTTGGGGGTGGGGATATGG + Intergenic
1058929254 9:109702586-109702608 CTGTTGTGGGGGTGGGGGTAGGG + Intronic
1058942488 9:109826208-109826230 CTGTTGTGGGGGTGGGGGTAGGG + Intronic
1059139899 9:111843104-111843126 CTGTGTATGAGGTGGGGGTAGGG + Intergenic
1059446682 9:114342502-114342524 CTGTGGTTGGGGCGGGGGGTTGG - Intronic
1062236512 9:135512509-135512531 CTGTGTCAGGGTCTGGGGAAGGG + Intergenic
1062244932 9:135561427-135561449 CTGTGTCCAGGGCAGGGGTATGG - Intergenic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315935 9:135967023-135967045 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315947 9:135967058-135967080 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315959 9:135967093-135967115 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1185552868 X:997949-997971 CTGTGTTACTGGCGGGAGAAGGG - Intergenic
1185749964 X:2603059-2603081 CTGTGAAAAGGTCGGGGGTAGGG + Intergenic
1187528119 X:20072238-20072260 GTGTGTTGGGGGTGGGGCTATGG - Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189137406 X:38562920-38562942 GTGGGTGAGGGGCGGGGGTGAGG - Intronic
1189333450 X:40156363-40156385 GTTTTTTCGGGGCGGGGGTAGGG + Intronic
1189665406 X:43349963-43349985 CTGTGTGTGGGGTGGGGGTGGGG + Intergenic
1190666942 X:52704829-52704851 GTGTGTGTGGGGTGGGGGTAGGG + Intronic
1190672476 X:52753579-52753601 GTGTGTGTGGGGTGGGGGTAGGG - Intronic
1190991009 X:55550347-55550369 TTGTGTTAGGGGCAGAGGTGAGG + Intergenic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1191813066 X:65210913-65210935 CTGTGGTGGGGTCGGGGGGAGGG + Intergenic
1191909785 X:66137138-66137160 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic
1192002528 X:67169710-67169732 CTGTGGTGGGGTCGGGGGGAGGG + Intergenic
1192864387 X:75115780-75115802 GTGTGTTGGGGGGGGGGGCACGG + Intronic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1194980519 X:100435522-100435544 GTGTGTTAGAGGCCTGGGTAAGG - Intergenic
1196276004 X:113766100-113766122 TTGTGTTAGGGTCAGGGGAAGGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1199694924 X:150337160-150337182 CTGTGAGAGGGGCTGGGGTCAGG - Intergenic
1199844159 X:151678762-151678784 GTGAGGTAGAGGCGGGGGTAGGG - Intergenic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic
1201793332 Y:17866340-17866362 CTGTGGTGGGGTCGGGGGAAGGG + Intergenic
1201808222 Y:18039646-18039668 CTGTGGTGGGGTCGGGGGAAGGG - Intergenic