ID: 931324579

View in Genome Browser
Species Human (GRCh38)
Location 2:61205973-61205995
Sequence CTTCCACTAGGTTTTTACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931324579 Original CRISPR CTTCCACTAGGTTTTTACAC GGG Intronic
909538094 1:76760730-76760752 CTTTCACTAGGGGTTGACACGGG - Intergenic
910799832 1:91133967-91133989 CTTCCTCTAGGTTGTTACATGGG + Intergenic
912654584 1:111474499-111474521 CTTACACTAGGCTTTGCCACTGG - Intronic
915628137 1:157129657-157129679 CTTCTACTAGCTTATTACAGTGG + Intronic
920323888 1:205146263-205146285 CTTCCAGTATGTTTGTACATAGG + Exonic
1066276309 10:33871898-33871920 CTTCCACCAGGTTTTCAAACAGG + Intergenic
1066798921 10:39161332-39161354 CTTCCTTTAAGTTTTTACCCTGG - Intergenic
1066932700 10:41784918-41784940 CTTCCACCAAGTTTTTATCCTGG - Intergenic
1068127424 10:52858103-52858125 TTTGTACAAGGTTTTTACACTGG + Intergenic
1073826277 10:107326494-107326516 TTTTCAATAGGTTTTTACACAGG - Intergenic
1080199660 11:29653944-29653966 CTTCCTCTAGGTTTTAATCCTGG - Intergenic
1082057821 11:47834559-47834581 CTTGCTCTAGGTTTTTAGATTGG - Intronic
1082573999 11:54780429-54780451 CTTCCACTTAGTTTTTATCCTGG - Intergenic
1082584694 11:54921785-54921807 CTTCCTTTTAGTTTTTACACTGG + Intergenic
1086304451 11:85464725-85464747 CTTTCATTAGATTTTTACAAAGG + Intronic
1089428245 11:118399231-118399253 CTGCCACTAGCTTTTAATACTGG - Intronic
1091370021 11:135049956-135049978 CTTCCTCTAGGTGTTTGAACAGG - Intergenic
1091868367 12:3863266-3863288 ATTCCATTAGATTTTTACATAGG + Intronic
1092224301 12:6737135-6737157 CTTCCTTTAGGATTTTACAGCGG - Intergenic
1104357616 12:128101601-128101623 CTTCCCCTAGGGTTCTCCACTGG - Intergenic
1106440599 13:29763881-29763903 CTTCTATGAGGCTTTTACACAGG - Intergenic
1108793583 13:54003076-54003098 CTTCCACCATGTTTTCAGACTGG + Intergenic
1110514008 13:76387175-76387197 TTTGCATTAGCTTTTTACACTGG + Intergenic
1112982702 13:105406039-105406061 CTTTAACTATGGTTTTACACAGG + Intergenic
1114138343 14:19880603-19880625 CTTCCACTAGAAAATTACACTGG + Intergenic
1117124703 14:52609802-52609824 CTCCCAGCAGGTATTTACACAGG + Intronic
1118389297 14:65282704-65282726 CTTCCACTAGGATTGGAGACCGG + Intergenic
1118856910 14:69630276-69630298 CTTCCACAAGATCTTTACAGTGG - Intronic
1127414331 15:58743121-58743143 ATTTCATTTGGTTTTTACACGGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136866395 16:33759972-33759994 CTTTCACTAGGTTGTTATATAGG + Intergenic
1203012074 16_KI270728v1_random:303822-303844 CTTCCTCTAAGTTTTTATCCTGG - Intergenic
1203030409 16_KI270728v1_random:576981-577003 CTTCCTCTAAGTTTTTATCCTGG - Intergenic
1203041312 16_KI270728v1_random:757450-757472 CTTCCTCTAAGTTTTTATCCTGG + Intergenic
1203105765 16_KI270728v1_random:1356228-1356250 CTTTCACTAGGTTGTTATATAGG - Intergenic
1203127749 16_KI270728v1_random:1606140-1606162 CTTTCACTAGGTTGTTATATAGG + Intergenic
1157998572 18:52588724-52588746 CTTCCACTGGGTCTTTATACAGG - Intronic
1159397556 18:67882731-67882753 CCTCCTCTATGTTTTTACAATGG - Intergenic
1162419110 19:10555730-10555752 CTTCCAGTAGGTTTGGAAACAGG - Intronic
1167815196 19:51874447-51874469 CTGCCTCTGGGTTTTCACACTGG - Intronic
925824130 2:7830544-7830566 CTTAGACTAGGGTTTTACAGAGG - Intergenic
926331085 2:11826037-11826059 CTTTCACTTGTTTATTACACTGG + Intronic
931324579 2:61205973-61205995 CTTCCACTAGGTTTTTACACGGG + Intronic
933260188 2:80123797-80123819 CTTCCATTAGATGTTTTCACAGG + Intronic
933439032 2:82286279-82286301 CTTCCACTTGCTTTGTTCACAGG - Intergenic
934635088 2:95978548-95978570 CTTTCACTAGGTTGTTAAATAGG + Intronic
934798541 2:97126686-97126708 CTTTCACTAGGTTGTTATATAGG - Intronic
934834889 2:97576805-97576827 CTTTCACTAGGTTGTTATATAGG + Intronic
936392743 2:112090200-112090222 CTTCCTCTAGGCTTTTCCAATGG - Intronic
937024965 2:118690378-118690400 CTTCCACTAGGTATTTATTGAGG - Intergenic
937024989 2:118690497-118690519 CTTCCACTAGGTATTTATTGAGG - Intergenic
944986717 2:205185552-205185574 CTGCTAATATGTTTTTACACTGG - Intronic
1168946922 20:1768688-1768710 CTTCCACTTGATTCTTGCACAGG - Intergenic
1172691900 20:36795992-36796014 CTTCAACCAGGTTATTCCACGGG - Intronic
1172888578 20:38247743-38247765 CTTCCACCTGGTGATTACACTGG - Intronic
1177281709 21:18989580-18989602 GTTCCACTTGGCATTTACACAGG + Intergenic
1179820529 21:43934470-43934492 CCTCCACTAGGATGTTATACAGG + Intronic
1183627874 22:39015634-39015656 CTTCCCATAGGTTTTTAAATTGG - Exonic
1183630451 22:39029402-39029424 CTTTCAGTAGGTTTTTAAAGTGG - Exonic
956093109 3:65688619-65688641 ATTCCACTGGGTTTTGACATTGG + Intronic
963390933 3:144663478-144663500 CTTCCACCAGACTTTTACAGTGG + Intergenic
964695355 3:159502020-159502042 CTTCCACTAGTTAGTTCCACTGG + Intronic
969363372 4:6679502-6679524 CTTCCTCTAGGCTCATACACAGG - Intergenic
972130179 4:35823107-35823129 CTTCTCCTAGATTTTTAAACAGG - Intergenic
973025524 4:45265053-45265075 ATTCCTCTAGATTTTAACACAGG + Intergenic
973228979 4:47820137-47820159 CTGCCACTATGTATTTAAACTGG - Intronic
973652782 4:53013343-53013365 CTTCCATTATTTATTTACACAGG - Intronic
975640380 4:76494331-76494353 ATTGCACTAGGGTTTTACCCTGG + Intronic
980758241 4:137193008-137193030 CTTCCACTAACTTTTACCACTGG - Intergenic
983933190 4:173475431-173475453 CTTCCAGTAAGTTTTAACAGGGG - Intergenic
984937921 4:184905586-184905608 CTTCCAGTAGGCTTTAACTCTGG - Intergenic
990311426 5:54542537-54542559 CTTCAGCTAGGTGTTTACTCTGG + Intronic
990563121 5:57003505-57003527 ATTCCATTTGGTTTTTATACTGG + Intergenic
998180185 5:139931968-139931990 TTTCCACTAGCTTTGTACAATGG - Intronic
1000274957 5:159725851-159725873 CTTCCACAAGACTTTTGCACAGG + Intergenic
1004612445 6:17256443-17256465 CTTACAGTATGTTTTTAAACTGG + Intergenic
1009633197 6:66226686-66226708 TTACCACTAAGTGTTTACACAGG - Intergenic
1013433969 6:110082906-110082928 CTGGCACTAGGTTTCTAAACTGG + Intergenic
1013896738 6:115097783-115097805 CTGCCTCTAGGTCTTTACAATGG + Intergenic
1018490362 6:164286533-164286555 CTTCCACTAGGGTATGACATTGG - Intergenic
1025524650 7:61789616-61789638 CTTCCTCTTAGTTTTTATACTGG + Intergenic
1025528833 7:61850338-61850360 CTTCCACTTAGTTTTTTCCCTGG + Intergenic
1025529062 7:61853924-61853946 CTTCCTCTAAGTTTTTATCCTGG + Intergenic
1025548023 7:62202004-62202026 CTTCCTCTTAGTTTTTATACTGG + Intergenic
1025579323 7:62691468-62691490 CTTCCTTTGGGTTTTTACCCTGG - Intergenic
1029882180 7:103826160-103826182 CTTCCACCATGTTATGACACAGG + Intronic
1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG + Intergenic
1041233045 8:55772841-55772863 CTTCCCCTTGGCTTTTACACCGG + Intronic
1041442053 8:57907791-57907813 ATTCCACCAGGTTCTTACAGTGG + Intergenic
1042669977 8:71250615-71250637 CTCCCACTATGTTTTTTCAGAGG - Intronic
1045487653 8:102644739-102644761 CTGCCTCTAATTTTTTACACAGG - Intergenic
1049479507 8:142814591-142814613 CTTCCACTCTGTTTTGACTCTGG + Intergenic
1052090762 9:24324076-24324098 CTTCCACAAGGTTTCACCACTGG - Intergenic
1052111882 9:24595793-24595815 CTTCAACTATGTTTTTAGAATGG + Intergenic
1052593310 9:30527131-30527153 CTTCCACAGTGTTTATACACTGG + Intergenic
1055817427 9:80222955-80222977 CTGTCACTAGGTTTTAGCACAGG + Intergenic
1056200924 9:84275642-84275664 CCTCCATTAGGTTGTTTCACTGG + Exonic
1058965929 9:110038455-110038477 CTTTCACCAGGATTTAACACAGG - Intronic
1060506904 9:124204637-124204659 CTACCACCAGGTTTTTACAAAGG + Intergenic
1188579869 X:31698571-31698593 CTTCCACAAGGCATTTAAACAGG + Intronic
1197292482 X:124675893-124675915 CTTCCACTAGATATTCACAATGG - Intronic
1197886692 X:131225422-131225444 CTTCCACAAGTTGTTTTCACAGG - Intergenic
1199348740 X:146774568-146774590 CTTCCACTTGGTCTCAACACAGG + Intergenic
1202585589 Y:26422600-26422622 CTTTCACTAGGTTGTTATATAGG - Intergenic