ID: 931325604

View in Genome Browser
Species Human (GRCh38)
Location 2:61218947-61218969
Sequence AGTGACTTTCTTCCAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 673}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931325604_931325607 20 Left 931325604 2:61218947-61218969 CCATTCCTTGGAAGAAAGTCACT 0: 1
1: 1
2: 4
3: 33
4: 673
Right 931325607 2:61218990-61219012 AGGAATTAAGCTCCACCTCCTGG 0: 1
1: 5
2: 25
3: 56
4: 224
931325604_931325608 21 Left 931325604 2:61218947-61218969 CCATTCCTTGGAAGAAAGTCACT 0: 1
1: 1
2: 4
3: 33
4: 673
Right 931325608 2:61218991-61219013 GGAATTAAGCTCCACCTCCTGGG 0: 1
1: 5
2: 7
3: 30
4: 196
931325604_931325606 0 Left 931325604 2:61218947-61218969 CCATTCCTTGGAAGAAAGTCACT 0: 1
1: 1
2: 4
3: 33
4: 673
Right 931325606 2:61218970-61218992 AAGCTCATACTCAATGAGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 141
931325604_931325609 22 Left 931325604 2:61218947-61218969 CCATTCCTTGGAAGAAAGTCACT 0: 1
1: 1
2: 4
3: 33
4: 673
Right 931325609 2:61218992-61219014 GAATTAAGCTCCACCTCCTGGGG 0: 1
1: 2
2: 8
3: 35
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931325604 Original CRISPR AGTGACTTTCTTCCAAGGAA TGG (reversed) Intronic
900729541 1:4245908-4245930 AGTGACTTTCTTCACAGAATTGG - Intergenic
901227414 1:7621804-7621826 AGTGACCTTCTTGGAAGCAATGG - Intronic
901245035 1:7723555-7723577 AGTGACTTAGTTCCAAAGAACGG + Intronic
902105229 1:14029998-14030020 AATGACTTTCTTCAAAGAATTGG - Intergenic
902781379 1:18707052-18707074 AGTGACTCCCTTCCAAGCCAGGG - Intronic
904219543 1:28954578-28954600 AGTAACTTTTTTTTAAGGAAAGG + Intronic
904420932 1:30390916-30390938 AGTGATTATCATCCAAAGAAGGG + Intergenic
905265655 1:36752945-36752967 AGTGACTTCCTTCCACTGCATGG + Intergenic
905525029 1:38630670-38630692 AATGACTTTCTTCCCAGAATTGG - Intergenic
906358805 1:45134134-45134156 AGTGACTTTCTTCACAGAATTGG - Intronic
906756035 1:48316150-48316172 AGTGACTTTCTTCATAGAATTGG + Intronic
906919117 1:50044554-50044576 ACTTACTTTCTTCCTTGGAAAGG - Intergenic
907568546 1:55460730-55460752 AATGACTTTCTTCCCAGAATTGG + Intergenic
907580004 1:55563346-55563368 AATGACTTTCTTCCCAGAATTGG - Intergenic
907878599 1:58520718-58520740 AGTGATTTTATTGCAAGAAAAGG + Intronic
908177992 1:61574907-61574929 AGTGACTTTCTTCACAGAATTGG - Intergenic
908735846 1:67276036-67276058 AGTGACTTTCTTCACAGAATTGG + Intergenic
908952435 1:69577903-69577925 AATGACTTTCTTCAAAGAATTGG - Intronic
909668502 1:78162558-78162580 AATGACTTTCTTCAAAGAATTGG + Intergenic
909704364 1:78563808-78563830 AGTGACTTTCTTCACAGAATTGG + Intergenic
909807506 1:79890083-79890105 AGTGACTTTCTTCACAGAATTGG - Intergenic
910029226 1:82696299-82696321 AGTTTTTTTCTTCCAATGAATGG - Intergenic
910077192 1:83295517-83295539 ATTGACTCACTTCTAAGGAATGG + Intergenic
910816126 1:91292670-91292692 AATGACTTTCTTCACAGAAATGG + Intronic
910929834 1:92432284-92432306 ACTGACTTTCTTCAAAGAATTGG - Intergenic
911670257 1:100599761-100599783 AATGACTTTCTTCCCAGAATTGG - Intergenic
911674214 1:100640690-100640712 ATGGTCTTTCTTCCAAGAAAAGG + Intergenic
912157667 1:106942037-106942059 AGTGAATTTCTTCCAGTGACTGG - Intergenic
912285004 1:108359841-108359863 AGTGACTTTCTTCACAGAATTGG - Intergenic
913205212 1:116532496-116532518 AGTGGGTTTCTTCAAATGAAAGG + Intronic
913310268 1:117483262-117483284 AATGACTTTCTTCACAGAAATGG - Intronic
913418937 1:118642370-118642392 AGTGACTTTCTTCACAGAATTGG + Intergenic
913512937 1:119578808-119578830 ACTGACTTTCTTCAAAGAATTGG + Intergenic
913580353 1:120220523-120220545 AGTGACTTTCTTCACAGAATTGG - Intergenic
913627827 1:120677875-120677897 AGTGACTTTCTTCACAGAATTGG + Intergenic
913715882 1:121533754-121533776 AATGACTTTCTTCCCAGAATTGG - Intergenic
913732793 1:121735020-121735042 AATGACTTTCTTCCCAGAATTGG + Intergenic
914964182 1:152238624-152238646 AGTGACTTTCTTCACAGAATTGG + Intergenic
915251272 1:154590450-154590472 CCTGACATTGTTCCAAGGAAGGG + Intronic
915750008 1:158198243-158198265 AATGCCTTTCTTCCAAGAACTGG - Intergenic
915763649 1:158340689-158340711 AGTGACTTTCTTCACAGAATTGG + Intergenic
915798522 1:158763190-158763212 AGTGACTTTCTTCACAGAATTGG - Intergenic
915829701 1:159115301-159115323 AGTGACTTTCTTCACAGAATTGG + Intronic
916596060 1:166244579-166244601 AATGACTTTCTTCAAAGAATTGG - Intergenic
916642117 1:166741433-166741455 ATTGGATTGCTTCCAAGGAAAGG - Intergenic
916735453 1:167603194-167603216 AGTGACTTGCACCCAAGGGAAGG + Intergenic
917042007 1:170815377-170815399 AGTGACTTTCTTCACAGAATTGG + Intergenic
917391347 1:174540817-174540839 AGTGACTTTCTTCACAGAATTGG - Intronic
917658801 1:177156709-177156731 AGTGACTTCCTTCAAAGGAATGG + Intronic
917794674 1:178524334-178524356 AGTGACTTGCTTCTAATGAATGG + Intronic
918517606 1:185380125-185380147 AATGACTTTCTTCCCAGAATTGG - Intergenic
919189803 1:194201846-194201868 AGTGACTTTCTTCACAGAATTGG - Intergenic
919285689 1:195556795-195556817 AGTCACTGTATTCCAAGGATTGG + Intergenic
921211242 1:212900443-212900465 AGTGATTTTCTTCAAATGCAAGG + Intergenic
921776299 1:219104209-219104231 AATGACTTTCTTCAAAGAATTGG - Intergenic
922066639 1:222150291-222150313 AATGACTTTCTTCAAAGAATTGG + Intergenic
922393566 1:225172731-225172753 AGTGACTTTCTTCACAGAATTGG + Intronic
1062773098 10:120431-120453 AGTGACTTTCTTCACAGAATTGG - Intergenic
1063340297 10:5256760-5256782 AATGACTTTCTTCCCAGAATTGG + Intergenic
1064779406 10:18818392-18818414 AATGACTTTCTTCACAGAAATGG + Intergenic
1064900720 10:20292934-20292956 AATGACTTTCTTCCCAGAATTGG - Intergenic
1065043977 10:21728696-21728718 AGGGTCTTTCTTCCAAGAATGGG + Intronic
1065414779 10:25472486-25472508 AATGACTTTCTTCACAGAAATGG - Intronic
1065427858 10:25624144-25624166 AATGACTTTCTTCCTAGAATTGG + Intergenic
1065856935 10:29838795-29838817 TGTGACTTTCCTCCAAGCACGGG + Intergenic
1066019755 10:31286503-31286525 AGTGACTTTCTTCACAGAATTGG + Intergenic
1066077498 10:31894716-31894738 AGTGACTTTCTTCACAGAATTGG + Intronic
1066155115 10:32667892-32667914 AGTGACTTTCTTCACAGGATTGG - Intronic
1066410991 10:35169121-35169143 AATGACTTTCTTCAGAGAAATGG - Intronic
1066505512 10:36038466-36038488 AGTGCCTTTGTTCCTGGGAAGGG + Intergenic
1066619639 10:37332351-37332373 AGTGCCCATCATCCAAGGAACGG + Intronic
1067332770 10:45337447-45337469 AGTGGCTGACTTCCAATGAAGGG + Intergenic
1068734503 10:60397368-60397390 ACTGACTTCCTGCCATGGAAAGG + Intronic
1068943317 10:62703114-62703136 AATGACTTTCTTCAAAGAATTGG + Intergenic
1071141103 10:82510369-82510391 AGAGCCCTTCTTCCATGGAAGGG - Intronic
1071386893 10:85130338-85130360 AATGACTTTCTTCAAAGAATTGG + Intergenic
1071468812 10:85964253-85964275 ATTGACTTTCTTCAAAGAATTGG + Intronic
1072406451 10:95158413-95158435 AATGACTTTCTTCACAGGATTGG + Intergenic
1072781305 10:98253586-98253608 ACTGACTTTCGTCCAAAGACTGG - Exonic
1072826505 10:98611962-98611984 AGTGACTTTCTTTAAAAGCATGG - Intronic
1073694657 10:105851105-105851127 AATGACTTTCTTCACAGGATTGG + Intergenic
1073949875 10:108795163-108795185 AGTGACTTTCTTCACAGAATTGG - Intergenic
1073951848 10:108818574-108818596 AGTGACTTTTGGCCAATGAAAGG - Intergenic
1074408857 10:113206310-113206332 AGTGACATTCTTCACAGAAATGG + Intergenic
1074452539 10:113570881-113570903 AGTTAGTTTCTTAAAAGGAAGGG - Intronic
1075839278 10:125485751-125485773 AGTGACTTCCTTCCAAAGTGTGG + Intergenic
1076989779 11:266954-266976 AGTGACTTTCATGGAGGGAAAGG + Intergenic
1077930886 11:6731589-6731611 AATGACTTTCTTCCCAGAATTGG + Intergenic
1077952389 11:6974418-6974440 AATGACTTTCTTCCCAGAATTGG - Intronic
1077986808 11:7360375-7360397 AATGACTTTCTTCCCAGAATTGG - Intronic
1078349336 11:10580024-10580046 AGTGAGTTTCTTACAAGAACAGG - Intronic
1078799586 11:14629691-14629713 AATGACTTTCTTCCCAGAATTGG - Intronic
1078818266 11:14848954-14848976 AATGACTTTCTTCCCAGAATTGG + Intronic
1079864682 11:25720273-25720295 AATGACTTTCTTCACAGAAATGG - Intergenic
1080005481 11:27401831-27401853 ATTGACTTTTCTCTAAGGAAGGG - Intronic
1080365182 11:31565896-31565918 AGTGACTTTCTTCACAGAATTGG - Intronic
1081371259 11:42306348-42306370 AGTTTGTTTCTTCCAAGGATTGG - Intergenic
1081732193 11:45379460-45379482 ATTGCCTTTCTTCCAACGCAAGG - Intergenic
1082107086 11:48232196-48232218 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082144048 11:48645725-48645747 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082148480 11:48701355-48701377 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082292111 11:50388467-50388489 AGTGACTTTCTTCACAGAATTGG + Intergenic
1082599980 11:55137309-55137331 AATGACTTTCTTCACAGAAATGG + Intergenic
1082677799 11:56129905-56129927 AGTGACTTTCTTCAAAGGACTGG + Intergenic
1082905647 11:58305670-58305692 AATGACTTTCTTCACAGAAATGG - Intergenic
1085820749 11:79790739-79790761 AATGACTTTCTTCCCAGAATTGG - Intergenic
1086024812 11:82278002-82278024 AATGACTTTCTTCCCAGAATTGG - Intergenic
1086025166 11:82281946-82281968 AATGACTTTCTTCCCAGAATTGG + Intergenic
1086914792 11:92517099-92517121 ATTGACTTTCTTCAAAGAATTGG + Intronic
1087087437 11:94234047-94234069 AGTGACTTTCTTCACAGAATTGG - Intergenic
1087103610 11:94388791-94388813 AGTGACTTTCTTCACAGAATTGG + Intronic
1087312435 11:96560195-96560217 AATGACTTTCTTCACAGGATTGG + Intergenic
1087547782 11:99606565-99606587 AATGACTTTCTTCAAAGAATTGG + Intronic
1087859579 11:103137750-103137772 AGTGACTTTCTTCACAGAATTGG - Intronic
1087888201 11:103505072-103505094 AGTGACTTTCTTCACAGAATTGG + Intergenic
1088122718 11:106388873-106388895 AGTGACTTTCTTCACAGAATTGG - Intergenic
1088370103 11:109079603-109079625 AATGACTTTCTTCCCAGAATTGG - Intergenic
1089474731 11:118749805-118749827 AGTAACTTTTTTCCAGGGAGGGG - Exonic
1091598968 12:1906066-1906088 ACTGCCTTTCTTCCATTGAATGG - Intronic
1091756668 12:3056836-3056858 AGAGACTTCCTTCCATGGAAAGG + Intergenic
1092318806 12:7449013-7449035 AGTGATTTACTTCCAAAGCATGG + Intronic
1092473592 12:8799812-8799834 AGTGACTTTCTTCACAGAATTGG + Intergenic
1092691286 12:11113181-11113203 ATTGACTTTCTTCAAAGAATTGG + Intronic
1093256551 12:16874925-16874947 AGTGACTTTCTTCACAGAATTGG - Intergenic
1093463860 12:19430499-19430521 AATGACTTTCTTCATAGAAATGG - Intronic
1093522050 12:20062564-20062586 AGTGACTTGCTTCTAAGGGATGG + Intergenic
1093573833 12:20701715-20701737 AGTGACTTTCTTGGAGGAAAGGG + Intronic
1093961963 12:25283932-25283954 AGTGACTTGCTTTCAAAGTATGG + Intergenic
1093989815 12:25577215-25577237 AGTGACTTTCTTCACAGAATGGG - Intronic
1094378242 12:29814207-29814229 AGTGACTTTCTTCACAGAATTGG + Intergenic
1094739369 12:33271032-33271054 AATGACTTTCTTCACAGAAATGG + Intergenic
1095069683 12:37825441-37825463 AGTGACTTTCTTCACAGAATTGG + Intergenic
1095086387 12:38061134-38061156 AGTGACTTTCTTCACAGAATTGG - Intergenic
1095167647 12:38992282-38992304 ATTGACTTTCTTCACAGAAATGG + Intergenic
1095695286 12:45137071-45137093 ATTGACTTTCTTCAAAGAATTGG + Intergenic
1096969356 12:55653063-55653085 AGTGACTTTCTAGACAGGAAAGG + Intergenic
1097680598 12:62645605-62645627 ACTGAGTTTGTTCTAAGGAAAGG + Exonic
1098084473 12:66827531-66827553 TGTGACTTGCTTCCAACCAATGG - Intergenic
1098434680 12:70455992-70456014 ATTGACTTTCTTCACAGGATTGG - Intergenic
1098453405 12:70645569-70645591 AATGACTTTCTTCCACAGCATGG - Intronic
1098941913 12:76547749-76547771 AGTGACTTTGCTCCAGGGAATGG - Intronic
1099522924 12:83686155-83686177 ATTGACTTTCTTCAAAGAATTGG + Intergenic
1099524202 12:83698983-83699005 ACTGACTTTCTTCACAGGATTGG + Intergenic
1099547806 12:84007424-84007446 AGTGACTTTCTTCACAGAATTGG - Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1099637122 12:85227639-85227661 AATGACTTTCTTCACAGAAATGG + Intronic
1099735397 12:86562276-86562298 AGTGGCTGTCCTGCAAGGAAAGG + Intronic
1100579489 12:95925063-95925085 AGTGACTTTCTTCACAGAATTGG - Intronic
1101557696 12:105825893-105825915 AATGACTTTCTTCAAAGAATTGG + Intergenic
1101622475 12:106402428-106402450 AGTGACTTTCTTCACAGAATTGG + Intronic
1103636208 12:122307943-122307965 AGTGACTTACTTTTAAAGAATGG - Intronic
1105616445 13:22018456-22018478 AGTGACTGTGTTCCAAGCACTGG - Intergenic
1105925990 13:25008803-25008825 AGTGACTTTCTTCACAGAATTGG - Intergenic
1106153427 13:27128883-27128905 AGTGATTTTCTTCTCAGGAGTGG - Intronic
1106299334 13:28449781-28449803 AATGTCTTTCTTCTGAGGAAAGG - Intronic
1106418918 13:29569371-29569393 AGTGACTTTTTACAAAGGCAGGG - Intronic
1106959747 13:34984567-34984589 AGTGACTTTCTTCACAGAATTGG - Intronic
1106980604 13:35274973-35274995 ACTGACTTTCTTCAAAGAATTGG + Intronic
1108883055 13:55144576-55144598 AGTGATTTTCTTCCTAGAGAAGG - Intergenic
1108955263 13:56146835-56146857 CGTGACTTTCTTGCAACCAATGG + Intergenic
1108985086 13:56576681-56576703 AATGACTTTCTTCCCAGAACTGG + Intergenic
1109216460 13:59595244-59595266 AATGACTTTCTTCACAGAAATGG + Intergenic
1109572620 13:64212579-64212601 AATGACTTTCTTCAAAGAATTGG - Intergenic
1109871506 13:68339715-68339737 AGTGACTTTCTTCACAGAATTGG + Intergenic
1109972474 13:69787127-69787149 AGTGACTTTCTTCACAGAATTGG + Intronic
1110699539 13:78530657-78530679 AATGACTTTCTTCACAGGATTGG + Intergenic
1110908086 13:80918117-80918139 AGTGACTTTCTTCACAGAATTGG - Intergenic
1110917354 13:81038764-81038786 AATTACATTCTTCAAAGGAATGG + Intergenic
1111793250 13:92885454-92885476 AGTAACTTTATTCCAACCAAAGG - Intergenic
1111815102 13:93142735-93142757 AGAGACTTTCCTGCTAGGAAGGG - Intergenic
1112962275 13:105141329-105141351 AGTGACTCTCTTCCAATGTCTGG + Intergenic
1113010011 13:105753605-105753627 AATGACTTTCTTCACAGAAATGG + Intergenic
1114002464 14:18273113-18273135 AATGACTTTCTTCCCAGAATTGG - Intergenic
1114034571 14:18610695-18610717 AGTGACTTTCTTCACAGAATTGG + Intergenic
1114048389 14:18897184-18897206 AATGACTTTCTTCCCAGAATTGG + Intergenic
1114114124 14:19504462-19504484 AATGACTTTCTTCCCAGAATTGG - Intergenic
1114115824 14:19622214-19622236 AATGACTTTCTTCCCAGAATTGG - Intergenic
1114206987 14:20581344-20581366 AATGACTTTCTTGGAAGGCATGG + Intergenic
1114460635 14:22884139-22884161 AGTGAGCTTCTTCCTAGGAAAGG - Intronic
1115038118 14:28885739-28885761 AGTGACTTGCTTCCAACAAAAGG + Intergenic
1115065134 14:29250610-29250632 AGTGACTTTCTTCACAGAATTGG + Intergenic
1115302814 14:31903338-31903360 AGTGAGTCACTTCCAATGAAAGG - Intergenic
1115527387 14:34295033-34295055 AATGACTTTCTTCACAGGATTGG - Intronic
1115671761 14:35620979-35621001 AGTGACTTTCTTCACAGAATTGG + Intronic
1116461554 14:45180865-45180887 AGTGACTTGCTTCTAAAAAAAGG - Intronic
1117088523 14:52225980-52226002 AGTGACTTTCTTCACAGAATTGG + Intergenic
1117489593 14:56233221-56233243 AGTGACTTTCTTCACAGAATTGG + Intronic
1117491624 14:56253809-56253831 AGTGACTTTCTTCACAGAATTGG + Intronic
1117613296 14:57506156-57506178 AGAGATTTTCTTCAAAGGAAGGG - Intergenic
1117811900 14:59556083-59556105 AGTGACTTTCTTCACAGAATTGG + Intronic
1117884103 14:60341624-60341646 AATGACTTTCTTCACAGGATTGG + Intergenic
1117900228 14:60524775-60524797 AATGACTTTCTTCACAGGATTGG - Intergenic
1117927306 14:60795761-60795783 AAAGACATTCTTACAAGGAAAGG + Intronic
1118078321 14:62327665-62327687 AGTGACTTTCTTCACAGAATTGG + Intergenic
1118155415 14:63236205-63236227 AGAGACCTTGTTCCAAGAAAAGG - Intronic
1118791343 14:69095972-69095994 AGAGACTTTCTCCCATAGAAAGG - Intronic
1119700057 14:76748890-76748912 AGTGACTTTCTTCACAGAATTGG + Intergenic
1121541553 14:94731072-94731094 AGTGGCTTGCTTCCAAGTAGTGG + Intergenic
1122530151 14:102419568-102419590 AGAGACTCTCTTCCAGAGAAAGG + Intronic
1124479619 15:30066946-30066968 AGTGACTTTCTTCACAGAATTGG + Intergenic
1124668858 15:31619298-31619320 AGTGACTTTCTTCACAGAATTGG - Intronic
1125058173 15:35387365-35387387 AGTGACTTTCTTCACAGAATTGG - Intronic
1125919697 15:43518153-43518175 AGTGAGTTTTTGCCAAGTAAGGG + Intronic
1126132868 15:45360020-45360042 AGTGGCTTTCTTTAAGGGAAAGG + Intergenic
1127032199 15:54876304-54876326 AGTGACTTTCTTCATAGAATTGG + Intergenic
1127339953 15:58030999-58031021 AATGACTTTCTTCAAAGAACTGG + Intronic
1127686058 15:61346050-61346072 AGTGACTTTCTTCACAGAATTGG + Intergenic
1128220707 15:65966609-65966631 GGGGACCTTCTTCCAAGGAAGGG - Intronic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1129060633 15:72857853-72857875 AGTGACTCACTTCTAATGAATGG + Intergenic
1129548391 15:76422142-76422164 AGTGACTTTCTTCACAGAATTGG - Intronic
1129621571 15:77152011-77152033 AGTGACTTTCTTCACAGAATTGG - Intronic
1130637684 15:85640760-85640782 TGAGACTTTCTGCCAAGTAAAGG + Intronic
1130667565 15:85882739-85882761 AGTGACTTTCTTCACAGAATTGG + Intergenic
1131149369 15:90037266-90037288 AGGGACTTTCTTCCAAGGGAAGG - Intronic
1131556273 15:93402529-93402551 ACTGACTTTCTTCAAAGAACTGG - Intergenic
1131697692 15:94896824-94896846 AGGAACTTTCATTCAAGGAAAGG - Intergenic
1133717751 16:8465763-8465785 AGTGACTTTCTTCCAGGGAAGGG - Intergenic
1134764687 16:16746563-16746585 AATGACTTTCTTCAAAGAATTGG - Intergenic
1134870212 16:17646073-17646095 AGTGACTTGCTTCTAACTAATGG + Intergenic
1135513493 16:23109587-23109609 AGTGACTTACTTCCAAAGACAGG + Intronic
1135949396 16:26899217-26899239 AGTGACTGTCTTGGAAGGAGGGG + Intergenic
1136736754 16:32473920-32473942 GGTGACTTTCCCCCACGGAAGGG + Intergenic
1137318370 16:47351679-47351701 AGTGACTTTCTTCAGAGAATTGG + Intronic
1137370548 16:47901734-47901756 AGTGACTTTTTTCAAAGAATTGG + Intergenic
1137824616 16:51480775-51480797 AGTGACTTTCTTCACAGAATTGG - Intergenic
1138325146 16:56159108-56159130 AATGACTTTCTTCAAAGAATTGG + Intergenic
1138452969 16:57104809-57104831 AATGCCTTTCTTCACAGGAAAGG - Intronic
1139150707 16:64379117-64379139 AATATTTTTCTTCCAAGGAAAGG + Intergenic
1139170242 16:64621810-64621832 AGTGAGTTTCATCCCAGGAATGG - Intergenic
1139652513 16:68369557-68369579 AGTGACTTTCTGGGGAGGAAGGG - Intronic
1140695559 16:77529574-77529596 AATGACTTTCTTCAAAGAATTGG + Intergenic
1141411125 16:83833839-83833861 AGTGACTTCCTTCCAAAGAGGGG + Intergenic
1203016314 16_KI270728v1_random:355657-355679 GGTGACTTTCCCCCACGGAAGGG - Intergenic
1203034649 16_KI270728v1_random:628815-628837 GGTGACTTTCCCCCACGGAAGGG - Intergenic
1143618066 17:8065153-8065175 AGTGAGCTTCTTCAAAGGACAGG - Intergenic
1143832148 17:9660974-9660996 AGTGGCTTTCCTTCTAGGAAAGG - Intronic
1144277383 17:13686642-13686664 AGTGACATCCTTCCAAAGAATGG - Intergenic
1144369875 17:14579893-14579915 AATCACTCTCTACCAAGGAAGGG - Intergenic
1145126714 17:20306692-20306714 AGAGAGTCTCTTGCAAGGAAAGG + Intronic
1145688147 17:26699266-26699288 AATGACTTTCTTCACAGAAATGG + Intergenic
1145761535 17:27428544-27428566 AGTGACTTTCTTCACAGAATTGG - Intergenic
1145854778 17:28144315-28144337 AGTGACTCTCTTCAAAGCAGAGG - Intronic
1149901543 17:60484251-60484273 AATGACTTTCTTCACAGGATTGG - Intronic
1151043910 17:70896729-70896751 AGTTACTTTCTTTTTAGGAAAGG + Intergenic
1151119119 17:71772635-71772657 AGTGAGTTTCTTCCAACGCGAGG + Intergenic
1151212601 17:72555727-72555749 GGTGACTCTCTTCTAATGAAGGG + Intergenic
1151225404 17:72644353-72644375 AGCGATTTTATTCCCAGGAAAGG + Intergenic
1153317402 18:3738242-3738264 AGTGACTTTCTTCACAGAATTGG + Intronic
1154186247 18:12186235-12186257 AGTGACTTTCTTCACAGAATTGG + Intergenic
1154188079 18:12203969-12203991 AGTGACTTTCTTCACAGAATTGG - Intergenic
1154272344 18:12931108-12931130 AGTGTCTTTCTCCAAAGCAAAGG - Intergenic
1154272696 18:12933546-12933568 AGTGTCTTTCTCCAAAGCAATGG + Intergenic
1154288166 18:13080160-13080182 AGTGACTTTCTTCACAGAATTGG - Intronic
1155102028 18:22620834-22620856 AATGACTTTCTTCCCAGAATTGG + Intergenic
1155466270 18:26139088-26139110 AGTGACTTGCTTTTAAGGAATGG + Intronic
1156144930 18:34163708-34163730 AGTGACTTTCTTCACAGAACTGG + Intronic
1156983805 18:43325134-43325156 AGTGACTTTCTTCACAGAATTGG + Intergenic
1157088205 18:44604191-44604213 AGTCAGTTTCTTCCAGGGGAAGG - Intergenic
1158303228 18:56076103-56076125 GGTGACTTTCTGCCCAGCAATGG + Intergenic
1159165685 18:64696167-64696189 AGTGACTTATTTCCTATGAACGG - Intergenic
1163789383 19:19297542-19297564 AGTGACTCAGTTCAAAGGAAGGG - Intronic
1164355879 19:27428267-27428289 AATGACTTTCTTCAAAGAATTGG + Intergenic
1164377065 19:27696964-27696986 AATGACTTTCTTCAAAGAATTGG - Intergenic
1164495931 19:28761466-28761488 AATGACTTTCTTCAAAGAATTGG + Intergenic
1164522837 19:28991885-28991907 TGGGACTTTCTTCCTGGGAATGG + Intergenic
1165195411 19:34098663-34098685 AGTGACTTCCTTCCAAAAATGGG + Intergenic
1165260935 19:34617208-34617230 AATGACTTTCTTCAAAGAATTGG - Intronic
1168358333 19:55716798-55716820 AGGGATTTTCTACCAAGGAGAGG + Exonic
924989394 2:299090-299112 ATTGACTTTCTTCAAAGAATAGG + Intergenic
925395608 2:3531451-3531473 AGGGACACTCTTCCAAGGACAGG + Intergenic
926487008 2:13474313-13474335 AGTAACTGTCTGCCAATGAAGGG - Intergenic
928199021 2:29235212-29235234 AGTCACTTTCCTCCAAGGTCAGG - Intronic
928267915 2:29827784-29827806 AATGACTTTCTTCAAAGAATTGG + Intronic
930209643 2:48621525-48621547 TGTGACTTTCCTCTAAAGAAAGG - Intronic
930239818 2:48924497-48924519 AGTGACTTTCTTCACAGAATTGG + Intergenic
930294803 2:49541887-49541909 AGTGACATTCTTCACAGAAATGG + Intergenic
930975322 2:57451638-57451660 AGAGATTTCCTTCAAAGGAAAGG + Intergenic
931031155 2:58176247-58176269 AGTGACTTTCTTCACAGAATTGG + Intronic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
931843786 2:66181657-66181679 AGTGACTTTCTTCACAGAATTGG + Intergenic
931846639 2:66210841-66210863 AGTGACTTTCTTCACAGAATTGG + Intergenic
931864568 2:66395603-66395625 AGTGACTTTCTTCACAGAATTGG + Intergenic
932269888 2:70399965-70399987 AGGGACTTTGTTCCAAGGCAGGG + Intergenic
933880840 2:86668308-86668330 AATGACTTTCTTCACAGGATTGG + Intronic
934617483 2:95783073-95783095 AATGACTTTCTTCACAGGATTGG + Intergenic
934643410 2:96041486-96041508 AATGACTTTCTTCACAGGATTGG - Intergenic
934836825 2:97597555-97597577 AATGACTTTCTTCACAGGATTGG - Intergenic
934877732 2:97940941-97940963 AATGACTTTCTTCACAGGATTGG + Intronic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
934997862 2:98982474-98982496 AATGACTTTCTTCACAGGATTGG + Intergenic
935825638 2:106946301-106946323 AATGACTTTCTTCACAGGATTGG + Intergenic
935843607 2:107140792-107140814 AATGACTTTCTTCACAGGATTGG - Intergenic
935865389 2:107382099-107382121 AGTGACGTTCACCCAAGGACAGG - Intergenic
936553577 2:113473009-113473031 AGTGACTTTCTTCACAGAATTGG - Intronic
937719857 2:125081368-125081390 AGTGACTTTCTTCACAGAATTGG + Intergenic
938425755 2:131185691-131185713 AGTGACTTTCTTCACAGAATTGG + Intronic
939054179 2:137343186-137343208 ATTGACTTTTTTGCAAGGAATGG + Intronic
939382095 2:141448602-141448624 AGGGACTGTGTCCCAAGGAATGG - Intronic
939989403 2:148863328-148863350 AGTGACTTGCTTCTAATCAATGG + Intergenic
940602297 2:155877247-155877269 AATGACTTTCTTCAAAGAATTGG + Intergenic
941149530 2:161896438-161896460 AGTGACTTTCTTCACAGAATTGG - Intronic
941773645 2:169368487-169368509 AATGACTTTCTTCAAAGAATTGG + Intergenic
941934695 2:170973709-170973731 AGAGCCCTTCTTCCAAAGAACGG - Intergenic
942108012 2:172652938-172652960 AGTGACTTTCTTCACAGAATTGG + Intergenic
942247569 2:174021949-174021971 AGTGACTTACTTCTAACAAATGG + Intergenic
942435042 2:175962171-175962193 AGTGACTTTCTTCGCAGAATTGG + Intronic
942790295 2:179753461-179753483 AGTGACTTTCTTCACAGAATTGG - Intronic
943975702 2:194474061-194474083 AATGACTTTCTTCAAAGAATTGG + Intergenic
945031274 2:205665773-205665795 AGTTTCTTTCTTCCAAAGTATGG + Intergenic
945776389 2:214111652-214111674 AATGACTTTCTTCAAAGAATTGG - Intronic
946581938 2:221138638-221138660 AGGGATTTTATTCCTAGGAAAGG + Intergenic
946584751 2:221172652-221172674 AGTGACTTGTTTCCAGTGAATGG + Intergenic
947175164 2:227358889-227358911 GGTATCTTTCTTCCAAGGCAGGG + Intergenic
948351530 2:237344905-237344927 GGTGACTTTCTCCTAAGGAAAGG - Intronic
948395925 2:237645038-237645060 AGTGACTTGCTTCCAGAGCAGGG - Intronic
1169428617 20:5515710-5515732 AGTGACTTTCTTCACAGAATTGG - Intergenic
1169656601 20:7930919-7930941 AGTGGGTTACTTGCAAGGAAAGG - Intronic
1169911996 20:10654652-10654674 TTTGACTTTCTTTCAAGGTAGGG + Intronic
1171167936 20:22989113-22989135 AGTGACTTTCTTCACAGAATTGG - Intergenic
1171515439 20:25728678-25728700 AGTGACTTTCTTCACAGAATTGG + Intergenic
1171755988 20:29110155-29110177 AATGACTTTCTTCACAGAAATGG + Intergenic
1171768735 20:29304416-29304438 AGTGACTTTCTTCACAGAATTGG + Intergenic
1171861971 20:30409243-30409265 AATGACTTTCTTCACAGAAATGG + Intergenic
1171869068 20:30511800-30511822 AGTGCCCTTCTTCCTGGGAAGGG - Intergenic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1172832823 20:37850732-37850754 AGTTTCTTTCTTCCAAAGCAAGG - Intronic
1174392779 20:50228223-50228245 GGTGACTTTCTTCCATTGAAAGG + Intergenic
1175613165 20:60369068-60369090 AGTGACTTTCTTCACAGAATTGG - Intergenic
1176918220 21:14652159-14652181 AGTGACATTCTTCACAGAAATGG + Intronic
1177352877 21:19967650-19967672 AGTGACTTTCTTTGAAAGTAAGG + Intergenic
1177573601 21:22922310-22922332 AATGACTTTCTTCAAAGAATTGG + Intergenic
1177591838 21:23180783-23180805 AGTCACTGTCTTCCAAGCACTGG + Intergenic
1177727400 21:24987415-24987437 TGTGACTTTCTTACAAGGGAGGG + Intergenic
1178036650 21:28591328-28591350 AGTCACTGTGTTCCAAGGATTGG - Intergenic
1179536482 21:42055943-42055965 TGTTTCTTTCTTCCAAGAAAGGG + Intergenic
1180014160 21:45072138-45072160 AGTGCCATTCTTCCAAGTCAGGG + Intergenic
1180394683 22:12320271-12320293 AATGACTTTCTTCCCAGAATTGG - Intergenic
1180405060 22:12544477-12544499 AATGACTTTCTTCCCAGAATTGG + Intergenic
1180413029 22:12634026-12634048 AATGACTTTCTTCACAGAAATGG + Intergenic
1183950530 22:41350127-41350149 AGTGACTTTTGACCAGGGAAGGG + Intronic
949114483 3:303266-303288 AGTGACTTTCTTCACAGAATTGG - Intronic
949207772 3:1460584-1460606 AGTGACTTTCTTCACAGAATTGG - Intergenic
949209612 3:1482083-1482105 AGTGACTTTCTTCACAGAATTGG + Intergenic
949332242 3:2935377-2935399 AAGGACTTACTTGCAAGGAAGGG - Intronic
949427731 3:3937387-3937409 AGTGACTTTCTTCACAGAATTGG - Intronic
949842474 3:8334981-8335003 AGTGACTTTCTTCACAGAATTGG + Intergenic
951156019 3:19354348-19354370 AGTGACTTTCTTCACAGAATTGG + Intronic
951182747 3:19678203-19678225 AGTGACTTTCTTCACAGAATTGG - Intergenic
951291344 3:20875441-20875463 AATGACTTTCTTCCCAGAATTGG - Intergenic
951313793 3:21163406-21163428 AGCAATTTTCCTCCAAGGAAAGG + Intergenic
951413685 3:22396787-22396809 AGTGACTTTCTTCACAGAACTGG - Intergenic
951833388 3:26955157-26955179 AATGACTTTCTTCACAGAAATGG - Intergenic
952019210 3:28996931-28996953 AGTGACTTTCTTCACAGAATTGG - Intergenic
952692498 3:36226319-36226341 AATGACTTTCTTCACAGGATTGG + Intergenic
953523300 3:43663999-43664021 ACTGACTTTCTTCAAAGAATTGG + Intronic
954432062 3:50476066-50476088 AGGGACCCTCTTCCAAGGGAAGG - Intronic
955266079 3:57446292-57446314 AGTGATTTTTTTCTCAGGAAAGG + Intronic
955637660 3:61047599-61047621 AATGACTTTCTTCATAGGATTGG + Intronic
955642556 3:61101577-61101599 AGTGACTTTCTTCATAGAATTGG - Intronic
955814117 3:62823825-62823847 AGTCAGTTTATTCCCAGGAAAGG - Intronic
955832408 3:63018104-63018126 AGTGACTTTCTTCACAGAATTGG - Intergenic
956164500 3:66386168-66386190 ATTGTCTTTCTTCCAGGCAAAGG + Exonic
956615491 3:71167276-71167298 AGTGATTTTCTTCAAATCAAGGG - Intronic
956747302 3:72320065-72320087 AGTAAGTTTCTACCAGGGAATGG + Intergenic
957154301 3:76528120-76528142 AGTGACTTTCTACCAAGTGCAGG + Intronic
957666974 3:83245183-83245205 AGTGACTTTCTTCACAGAACTGG - Intergenic
957684260 3:83480130-83480152 AATGACTTTCTTCCAAAGCATGG - Intergenic
957801573 3:85090808-85090830 AGTGAGATTCTTCTAAGGAGTGG - Intronic
958058411 3:88444959-88444981 AGTAACTTTCTTCCAGGAAATGG - Intergenic
958074249 3:88656174-88656196 AGTGACTTTCTTCACAGAATTGG - Intergenic
958480136 3:94635250-94635272 AGTGACTTTCTTCACAGAATCGG + Intergenic
958621682 3:96570814-96570836 ACTGACTTTCTTCACAGAAATGG - Intergenic
959142906 3:102507214-102507236 AGTGAATTTGTGCCAAAGAATGG + Intergenic
959218119 3:103479678-103479700 AGTGACTTTCTTCACAGAATTGG - Intergenic
959893419 3:111581604-111581626 GGTGACTCCCTGCCAAGGAAAGG - Intronic
960643603 3:119853444-119853466 AATGACTTTCTTCACAGAAATGG - Intronic
960693605 3:120374138-120374160 AATGACTTTCTTCAAAGAATTGG - Intergenic
960838677 3:121934286-121934308 AATGACTTTCTTCAAAGAATTGG - Intronic
960859621 3:122138608-122138630 AATGACTTTCTTCAAAGAATTGG - Intergenic
961507635 3:127381146-127381168 ACTCTCTTTCCTCCAAGGAATGG - Intergenic
962474243 3:135741540-135741562 AGTAAATATTTTCCAAGGAAGGG - Intergenic
962697962 3:137969742-137969764 AATGACTTTCTTCACAGAAATGG + Intergenic
963134036 3:141884281-141884303 AGTGACCTTCCTGCAAGGCATGG + Intronic
963376019 3:144466035-144466057 AATGACTTTTTTGCAGGGAAGGG - Intergenic
963396384 3:144740093-144740115 AGTGACTTTCTTCACAGAACTGG - Intergenic
963505826 3:146183359-146183381 AATGACTTTCTTCAAAGAATTGG + Intergenic
963812033 3:149787096-149787118 AGTGACTTTCTTCACAGAATTGG - Intronic
963847327 3:150172438-150172460 AGAGACTTCCTTCCAAAGACAGG + Intergenic
964185074 3:153932876-153932898 AGTGACTTTCTTCACAGAATTGG + Intergenic
964657691 3:159086440-159086462 AATGACTTTCTTCAAAGAATTGG - Intronic
964678127 3:159306147-159306169 AGTAACTTTTTTCACAGGAAGGG + Intronic
964860067 3:161191833-161191855 AGTGACTTTCTTCACAGAATTGG - Intronic
964962829 3:162449195-162449217 ATTGACTTTCTTCCCAGAATTGG - Intergenic
964963306 3:162456257-162456279 AGTGACTTTCTTCACAGAATTGG + Intergenic
965217452 3:165881543-165881565 AATGACTTTCTTCCCAGAATTGG + Intergenic
965732213 3:171784092-171784114 AGTGATTTTCTTTCATAGAATGG + Intronic
967529029 3:190528401-190528423 AGAGACTCTTTTCCAAGGTAAGG + Intronic
967723334 3:192838342-192838364 AGTGACTTGCTTCTAATGCATGG - Intronic
967768587 3:193309549-193309571 AGTGGCTTACTCCTAAGGAAGGG + Intronic
968848805 4:3063630-3063652 GGTGACTCTCTTCCCAGAAATGG - Intergenic
970070722 4:12156683-12156705 TGTGACTTTCTTCACAGGATTGG - Intergenic
970096222 4:12465907-12465929 AATGACTTTCTTCAAAGAATTGG + Intergenic
970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG + Intergenic
970197156 4:13562530-13562552 AATGGCTTTCTTCTAAGTAATGG + Intergenic
970755303 4:19418665-19418687 AATGACTTTCTTCAAAGAATTGG + Intergenic
971770168 4:30885589-30885611 AATGACTTTCTTCAAAGAATTGG + Intronic
972373048 4:38444314-38444336 AATGACTTTCTTCACAGGATTGG - Intergenic
972932041 4:44083714-44083736 AGTTACTTTCTTGCAGAGAAAGG + Intergenic
972962515 4:44471616-44471638 GTTGACTTTCTTCCAAGTACAGG + Intergenic
973195757 4:47438560-47438582 AATGAATTTCTTCCAAATAAAGG - Intergenic
973705190 4:53573921-53573943 AGTGGTTTTCCTCCAAGGAGTGG + Exonic
974141689 4:57896261-57896283 AGTGACTTTCTTCACAGAATTGG - Intergenic
974162169 4:58154132-58154154 ATTGACTTTCTTCAAAGAATTGG + Intergenic
974288205 4:59896582-59896604 AATGACTTTCTTCACAGGATTGG + Intergenic
975291581 4:72683897-72683919 AATGACTTTCTTCAAAGAATTGG + Intergenic
975467601 4:74726369-74726391 AGTAACTTTCTTCCAAAAATAGG + Intergenic
976192037 4:82496757-82496779 ATTATCTTTCTTCCCAGGAATGG - Intronic
976573313 4:86638296-86638318 AATGACTTTCTTCCCAGAATAGG + Intronic
976585693 4:86794515-86794537 ACTGACTTTCTTCCCAGAATAGG + Intronic
977218414 4:94310659-94310681 AGTGACTTTCTTCACAGAATTGG - Intronic
977219383 4:94321286-94321308 AGTGACTTTCTTCACAGAATTGG - Intronic
977771316 4:100864330-100864352 ACTGACTTTCTTCCCAGAATTGG - Intronic
978517174 4:109580997-109581019 AATGACTTTCTTCAAAGAATTGG + Intronic
979821528 4:125178787-125178809 AATGACTTTCTTTCAAAAAAAGG + Intergenic
980488497 4:133492431-133492453 AGTGACTTTCTTCACAGAATTGG - Intergenic
980540397 4:134186154-134186176 AATGACTTTCTTCACAGAAATGG + Intergenic
981879550 4:149592980-149593002 AATGACTTTCTTCAAAGAATTGG - Intergenic
982120840 4:152142139-152142161 AATGACTTTCTTCACAGAAATGG + Intergenic
982236228 4:153253469-153253491 AGTGGCTCTCAGCCAAGGAATGG - Intronic
982536215 4:156609338-156609360 AATGACTTGCTTCTAAGAAATGG + Intergenic
982819752 4:159930592-159930614 AGTGACTTTCTTCACAGAATTGG - Intergenic
982836109 4:160121740-160121762 AGTGACTTTCTTCACAGAATTGG - Intergenic
983056953 4:163108907-163108929 GGTGAGTTTCTTACAAGAAAAGG + Intergenic
983668702 4:170211722-170211744 AATGACTTTCTTCCCAGAATTGG + Intergenic
983704772 4:170643888-170643910 AATGACTTTCTTCCCAGAATTGG + Intergenic
983802569 4:171952051-171952073 AGTTACTTTATTTCAAAGAATGG - Intronic
984692591 4:182744793-182744815 AATGACTTTCTTCAAAGTGAAGG + Intronic
985100551 4:186454079-186454101 AGTGACTTACGTCTAATGAATGG + Intronic
985494340 5:196264-196286 AGTGACTTTGTGCAAAGAAATGG + Intergenic
987279322 5:16396505-16396527 AGTGACTTTCTTCACAGAATTGG - Intergenic
987334093 5:16883522-16883544 TATGATTTTCTTCCAGGGAAGGG - Intronic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
987649781 5:20725914-20725936 AATGACTTTCTTCACAGGATTGG - Intergenic
987893711 5:23917468-23917490 AGTGACTTTCTTCACAGAATTGG - Intergenic
988397149 5:30709523-30709545 AATGACTTTCTTCAAAGAATTGG + Intergenic
988745776 5:34135582-34135604 AATGACTTTCTTCACAGGATTGG + Intergenic
988936649 5:36090116-36090138 AGTAACTTCCTGCCATGGAAAGG + Intergenic
989623403 5:43407109-43407131 AGTGACTTTCTTCACAGAATTGG + Intronic
990062663 5:51671190-51671212 AATGACTTTCTTCACAGGATTGG - Intergenic
990212752 5:53498249-53498271 AATGACTTTCTTCAAAGAATTGG + Intergenic
990226525 5:53661524-53661546 AATGACTTTCTTCAAAGAATTGG - Intronic
990859970 5:60316010-60316032 AATGACTTTCTTCAAAGAATTGG - Intronic
990870385 5:60425151-60425173 AATGACTTTCTTCACAGAAATGG + Intronic
991102489 5:62808325-62808347 ATTGACTTTCTTCAAAGAATTGG - Intergenic
991108317 5:62867756-62867778 AGTGACTTTCTTCACAGAATTGG + Intergenic
991280426 5:64907190-64907212 AATGACTTTCTTCAAAGAATTGG - Intronic
991321141 5:65374727-65374749 AATGACTTTCTTCACAGAAATGG + Intronic
991323691 5:65405669-65405691 AATGACTTTCTTCAAAGAATTGG - Intronic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
992604014 5:78436747-78436769 AGTGACTTTCTTCACAGAATTGG - Intronic
992751300 5:79865224-79865246 GATGTCTTTCTTACAAGGAAGGG - Intergenic
993305051 5:86266568-86266590 AGTGACTTTCTTCACAGAATTGG - Intergenic
993670558 5:90756342-90756364 ATTGACTTTGTTCACAGGAATGG - Intronic
994048942 5:95340797-95340819 AGTGACTTTCTTCACAGAATTGG + Intergenic
994161307 5:96559822-96559844 AGTGACTTTCTTCACAGAATTGG + Intronic
994270235 5:97768143-97768165 AGTGACTTTCTTCACAGAATTGG - Intergenic
994280672 5:97898677-97898699 AGTGACTTTCTTCACAGAACTGG - Intergenic
994405552 5:99341138-99341160 AATGACTTTCTTCATAGAAATGG - Intergenic
994442707 5:99830478-99830500 AATGACTTTCTTCACAGAAATGG - Intergenic
994599376 5:101882855-101882877 TGCAACTTTCTTCTAAGGAATGG - Intergenic
994723817 5:103411371-103411393 CATGATTTTCTTCTAAGGAATGG - Intergenic
995152443 5:108864881-108864903 AATGACTTTCTTCAAAGAATTGG - Intronic
995223855 5:109682213-109682235 TGTGCCTTTCTTCCCATGAAAGG - Intergenic
995302233 5:110597481-110597503 AGTGACTTTCTTCACAGAATTGG + Intronic
995644153 5:114292715-114292737 AATGACTTTCTTCCCAGAATTGG - Intergenic
995692419 5:114842409-114842431 AGTGACTTTCTTCACAGAATTGG + Intergenic
995715185 5:115075609-115075631 AGTGACTTTCTTCACAGAACTGG + Intergenic
995750267 5:115446668-115446690 AATGACTTTCTTCAAAGAATTGG + Intergenic
995814374 5:116150380-116150402 AGTGACTTTCTTCACAGAATTGG - Intronic
996186769 5:120487170-120487192 AGTGACTTTCTTCACAGAATTGG - Intronic
996625974 5:125570810-125570832 AATGACTTTCTTCACAGGATTGG + Intergenic
996630461 5:125625395-125625417 AATGACTTTCTTCACAGGATTGG + Intergenic
996788426 5:127266444-127266466 AATGACTTTCTTCAAAGAATTGG - Intergenic
996830521 5:127735451-127735473 AATGACTTTCTTCAAAGAATTGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998185666 5:139977561-139977583 AGTGACTTTCTTCACAGAATTGG + Intronic
998993081 5:147840185-147840207 ACTGGCTTTCTTCCAAATAATGG - Intergenic
998994204 5:147852519-147852541 AGTGACTTTCTTCCTAGGCTTGG - Intergenic
999072040 5:148753788-148753810 ACTGACTTTCTTCAAAGAAGTGG - Intergenic
999471855 5:151861898-151861920 AATGACTTTCTTCAAAGAACTGG + Intronic
999483772 5:151972587-151972609 AGTGACTTGCTTGCAATAAATGG + Intergenic
1001016429 5:168145703-168145725 AGTGACTTTCTTCACAGAATTGG - Intronic
1001354355 5:171005211-171005233 AGTGACTTTCTTCACAGAATTGG + Intronic
1001708584 5:173760119-173760141 AGTGACTTGCTTCTGATGAATGG - Intergenic
1001959227 5:175870409-175870431 GATGGCTTCCTTCCAAGGAAGGG - Intronic
1003437145 6:6101204-6101226 AGTGACTTTCTTCACAGAATTGG - Intergenic
1003441048 6:6142455-6142477 AGTGACTTTCTTCACAGAATTGG - Intergenic
1003446184 6:6186747-6186769 AGTGACTTTCTTCACAGAATTGG - Intronic
1003449320 6:6216144-6216166 AGTGACTTTCTTCACAGAATTGG + Intronic
1003457447 6:6296269-6296291 AGTGACTTTCTTCACAGAATTGG - Intronic
1003972710 6:11314379-11314401 AATAACTTCCTTCCAAAGAAAGG + Intronic
1004181919 6:13388231-13388253 AGTGACTTTCTTCACAGGATTGG + Intronic
1004241146 6:13924129-13924151 AGTGACTCTGTGCCAAGGACTGG - Intergenic
1004644075 6:17542634-17542656 ACTGACTTGCTTCCAAGAAGTGG + Intronic
1004799551 6:19131316-19131338 AATGACTTTCTTCACAGGATTGG + Intergenic
1004808016 6:19225443-19225465 AATGACTTTCTTCACAGGATTGG + Intergenic
1004831956 6:19486346-19486368 AATGACTTTCTTCACAGGATTGG + Intergenic
1004844344 6:19622989-19623011 AATGACTTTCTTCAAAGAATTGG + Intergenic
1004855446 6:19744981-19745003 AATGACTTTCTTCACAGAAATGG + Intergenic
1004946211 6:20616304-20616326 AGTGACTTTCTTCACAGAATTGG - Intronic
1005543937 6:26843817-26843839 AATGACTTTCTTCACAGGATTGG + Intergenic
1005892105 6:30148366-30148388 TGTGACTTGCTTCTAATGAATGG + Exonic
1006237642 6:32649250-32649272 AGTGACTTTCTTCACAGAATTGG + Intergenic
1008292054 6:49727947-49727969 AGTGACTCACTTCCAAAGAGTGG - Exonic
1009014717 6:57885487-57885509 AATGACTTTCTTCACAGGATTGG + Intergenic
1009278866 6:61721302-61721324 AGTGACTTTCTTCACAGAATTGG - Intronic
1009283020 6:61775760-61775782 AGTGACTTTCTTCATAGAATTGG + Intronic
1009485846 6:64220569-64220591 AGAGTCCTTCTCCCAAGGAAGGG - Intronic
1009743811 6:67785773-67785795 AGTGACTTTCTTCACAGAATTGG + Intergenic
1009867216 6:69412592-69412614 AGTGACTTTCTTCACAGAATTGG - Intergenic
1010295396 6:74190278-74190300 AATGACATTCTTCACAGGAAAGG - Intergenic
1010307233 6:74339274-74339296 AGTGACTTTCTTCACAGAACTGG - Intergenic
1010503009 6:76624357-76624379 AATGACTTTCTTCAAAGAATTGG - Intergenic
1010563293 6:77377471-77377493 AGTGACTTTATTCTAAGAAAAGG - Intergenic
1010598017 6:77788871-77788893 AGTGACTTTCTTCACAGAATTGG + Intronic
1010661083 6:78571248-78571270 AGTGACTTTCTTCACAGAATTGG + Intergenic
1010693950 6:78946902-78946924 AGGTATTTTCCTCCAAGGAATGG - Intronic
1010728653 6:79364417-79364439 AGTGACTTTCTTCATAGAATTGG - Intergenic
1010758302 6:79692880-79692902 AATGACTTTCTTCACAGGATTGG - Intronic
1010861084 6:80912654-80912676 AATGACTTTCTTCAAAGAATTGG + Intergenic
1010996950 6:82544532-82544554 AATGACTTTCTTCAAAGAATTGG - Intergenic
1011803826 6:91048670-91048692 AATGACTTTCTTCACAGGATTGG - Intergenic
1012088111 6:94855611-94855633 AATGACTTTCTTCCCAGAATTGG + Intergenic
1012567248 6:100673689-100673711 ATTCACTTTCTTCCAATCAAGGG - Intronic
1012678176 6:102143442-102143464 AGTGACTTTCTTCACAGAATTGG - Intergenic
1013168407 6:107614853-107614875 AGTGATTTTTTTACAAGGAGGGG - Intronic
1013710727 6:112894664-112894686 AGTGACTGTGTTCCAAGAACTGG + Intergenic
1013984528 6:116174232-116174254 AGTGACTTGCTTTCAAAAAACGG - Intronic
1014873153 6:126622078-126622100 AGTGATTTTCTACCAAGAGAAGG + Intergenic
1014892784 6:126863049-126863071 AGTGACTTTCTTCACAGAATTGG - Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1015045881 6:128775738-128775760 AGTGACTTTCTTCACAGAATTGG - Intergenic
1015080837 6:129223868-129223890 AGTGACTTTCTTCACAGAATTGG - Intronic
1016018904 6:139215095-139215117 AATGACTTTCTTCAAAGAATTGG + Intergenic
1016255053 6:142094675-142094697 AATGACTTTCTTCAAAGAATTGG - Intergenic
1016777232 6:147918082-147918104 AATGACTTTCTTCAAAGAATTGG - Intergenic
1018330621 6:162723927-162723949 AGAGACTATGTTCCAATGAATGG + Intronic
1019711643 7:2520679-2520701 AGAGCCTTTCTCCCCAGGAAGGG - Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1021069684 7:16220912-16220934 AGTGACTTTCTTCACAGAATTGG + Intronic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1021424685 7:20486654-20486676 AGTGACATTATTCCAGAGAAGGG + Intergenic
1022445042 7:30463266-30463288 ATTGATTTTCTTTTAAGGAAAGG + Intronic
1023161371 7:37299791-37299813 AGTGACTTTCTTCACAGAATTGG - Intronic
1023626143 7:42116989-42117011 AGTGTCTTTCCTCCAGGGACAGG + Intronic
1023670933 7:42575878-42575900 AGAGAGATTCTTCCAAGAAAGGG + Intergenic
1023744732 7:43312278-43312300 CATGATTTTCTTCCATGGAATGG - Intronic
1024368130 7:48547338-48547360 AGATACTTTGTTCCAGGGAAGGG - Intronic
1024397242 7:48883863-48883885 AATGACTTTCTTCACAGGATTGG - Intergenic
1024415134 7:49097100-49097122 TCTTACTTTCTTCCAAAGAAAGG - Intergenic
1024666660 7:51553658-51553680 AATGACTTTCTTCAAAGAATTGG - Intergenic
1024693878 7:51834988-51835010 AATGACTTTCTTCACAGGATTGG - Intergenic
1024718224 7:52105099-52105121 AATGACTTTCTTCAAAGAATTGG + Intergenic
1024738517 7:52331355-52331377 AATGACTTTCTTCAAAGAATTGG + Intergenic
1025096726 7:56101566-56101588 AGTCATTTTCTTCCAAGGTATGG - Exonic
1025183725 7:56839933-56839955 AGTGACTTTCTTCACAGAATTGG - Intergenic
1025688201 7:63737054-63737076 AGTGACTTTCTTCACAGAATTGG + Intergenic
1025839259 7:65129262-65129284 AGTGGCTTTGTTCCAAACAAGGG - Intergenic
1025883809 7:65566703-65566725 AGTGGCTTTGTTCCAAACAAGGG + Intergenic
1025889636 7:65635903-65635925 AGTGGCTTTGTTCCAAACAAGGG - Intergenic
1027114951 7:75471636-75471658 ACTGACTTTCATCGAAGGAGTGG + Intronic
1027294963 7:76760730-76760752 ATTGACTCACTTCTAAGGAATGG + Intergenic
1027374344 7:77536323-77536345 AGAGACTTTCCTCCATAGAATGG - Intergenic
1027404667 7:77846950-77846972 AGTGACTTAGTTCCCATGAAAGG + Intronic
1027442433 7:78233779-78233801 AGTGACTTCCTTCCAGAGCAAGG + Intronic
1027777738 7:82487566-82487588 ATTGACTTTCTTCCCAGAATTGG - Intergenic
1028055181 7:86232124-86232146 AATGACTTTCTTCAAAGAATTGG + Intergenic
1029460411 7:100691094-100691116 AGTTCCTTTAGTCCAAGGAAGGG - Intergenic
1029922572 7:104281144-104281166 AATGACTTTCTTCAAAGAATTGG + Intergenic
1029938886 7:104458639-104458661 AATGACTTTCTTCAAAGAATTGG - Intronic
1030077862 7:105751854-105751876 AGTGATTTTGATCCATGGAAAGG - Intronic
1030451999 7:109723723-109723745 AGTGACTTTCTTCACAGAATTGG + Intergenic
1030941266 7:115652699-115652721 ATTGCCTTTGTTCCAAGCAATGG + Intergenic
1031379552 7:121068638-121068660 AATGACTTTCTTCAAAGAATTGG - Intronic
1031394178 7:121251931-121251953 AATGACTTTCTTCAAAGAATTGG + Intronic
1031612142 7:123840510-123840532 AATGACTTTCTTCAAAGAATTGG - Intronic
1031641759 7:124173226-124173248 ACTGACTTTCTTCACAGAAATGG - Intergenic
1031852824 7:126886077-126886099 AGTGGCTTTGTTCCAAACAAGGG + Intronic
1031864867 7:127027358-127027380 ACTGACTTTCTTCAAAGAATTGG - Intronic
1033570711 7:142626139-142626161 AGTGAGTTTCCTATAAGGAAAGG - Intergenic
1033663357 7:143418898-143418920 AATGGCTTTTGTCCAAGGAATGG + Intergenic
1034408095 7:150919495-150919517 AGGGACTTGCTTCCAAAGAACGG - Intergenic
1034673630 7:152875879-152875901 ACTGACTTTCTTCACAGGATTGG - Intergenic
1034718997 7:153270748-153270770 AATGACTTTCTTCAAAGAATTGG + Intergenic
1035055976 7:156036966-156036988 CATGAATTTCTTCCAAGAAATGG - Intergenic
1035515623 8:230014-230036 AGTGACTTTATTTCAAATAAAGG + Intergenic
1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG + Intergenic
1035884012 8:3272454-3272476 AATGACTTTCTTCCCAGAATTGG - Intronic
1035990663 8:4486728-4486750 AGTGGCTTTCTTCCATGAAGGGG - Intronic
1036624076 8:10451449-10451471 AATGACTTTCTTCAAAGAATTGG - Intergenic
1037056026 8:14443278-14443300 AGTGACTTTCTTCACAGAATTGG + Intronic
1037133051 8:15429493-15429515 AGTGACTTTCTTCACAGAATTGG - Intronic
1037619845 8:20554150-20554172 AGTGGTTTTCTTCCAAAGAATGG - Intergenic
1039639217 8:39201147-39201169 AATGACTTTCTTCACAGAAATGG - Intronic
1039926592 8:41939243-41939265 AGTGACTTCCTTCCAGTAAAGGG + Intronic
1040321545 8:46310829-46310851 AATGACTTTCTTCAAAGAATTGG - Intergenic
1040458700 8:47625855-47625877 AGTGACTTTCTTCACAGAATTGG + Intronic
1040748086 8:50670660-50670682 AATGACTTTCTTCAAAGAATTGG + Intronic
1041128373 8:54668493-54668515 AATGACTTTCTTCACAGAAATGG + Intergenic
1041184453 8:55284731-55284753 CGTGACTTGCTTCTAATGAATGG - Intronic
1041423959 8:57699714-57699736 AGTGACTTTCTTCACAGAACTGG + Intergenic
1041470255 8:58200092-58200114 AATGACTTTCTTCACAGGATTGG - Intronic
1041961120 8:63616984-63617006 AGTGACTTTCTTCACAGAATTGG - Intergenic
1041973144 8:63766573-63766595 AGTGACTTTCTTCACAGAATTGG - Intergenic
1042362533 8:67898869-67898891 AGTGACTTTCTTCACAGAATTGG + Intergenic
1042541530 8:69912150-69912172 AGTGACTTTCTTCACAGAATTGG + Intergenic
1042580896 8:70278504-70278526 AGTGACTGACTTCTAAGGGAAGG - Intronic
1042636418 8:70880739-70880761 AATGACTTTCTTCACAGGATTGG + Intergenic
1042720788 8:71824863-71824885 AATGACTTTCTTCACAGAAATGG + Intergenic
1042750079 8:72148968-72148990 AATGACTTTCTTCACAGAAATGG - Intergenic
1043133820 8:76495920-76495942 AGTGTGTTTCTTGCAAGGAATGG + Intergenic
1044042718 8:87389719-87389741 AATGACTTTCTTCACAGAAATGG + Intronic
1044140579 8:88646654-88646676 AGTGACTTTCTTCACAGAATTGG - Intergenic
1045083588 8:98654952-98654974 AGTGACTTTCTTCACAGAATTGG + Intronic
1045882811 8:107061206-107061228 AGTGACTTTCTTCACAGAATTGG - Intergenic
1045898380 8:107245083-107245105 AATGACTTTCTTCCCAGAATTGG + Intergenic
1045933119 8:107649721-107649743 ACTGACTTTCTTCCCAGAATTGG - Intergenic
1045949333 8:107833824-107833846 AATGACTTTCTTCCCAGAATTGG - Intergenic
1046046513 8:108972057-108972079 AAAGCCTTTCTTCCAAGAAATGG - Intergenic
1046292961 8:112186494-112186516 AGTGACTTTCTTCACAGAATTGG + Intergenic
1046879910 8:119296638-119296660 AATGACTTTCTTCCCAGAATTGG + Intergenic
1047473022 8:125197714-125197736 AATGACTTTCTTCAAAGAATTGG - Intronic
1047547256 8:125830692-125830714 TGTGTATTTCTTCAAAGGAAAGG - Intergenic
1048091726 8:131248662-131248684 ATTGTCTTTTTTCCCAGGAATGG + Intergenic
1048540727 8:135339995-135340017 AGTGACTTTCTTCCCAGAATTGG + Intergenic
1048546637 8:135393556-135393578 AGTGACTTAATTGAAAGGAAGGG + Intergenic
1050505137 9:6340470-6340492 AATGACTTTCTTCAAAGAATTGG + Intergenic
1050597706 9:7220595-7220617 AGTGACTTTCTTCACAGAATTGG + Intergenic
1050814937 9:9798496-9798518 CGTTCCTTTCTTCCAAGGATAGG + Intronic
1050887385 9:10782885-10782907 AATGACTTTCTTCAAAGAACTGG + Intergenic
1050901201 9:10951111-10951133 AATGACTTTCTTCAAAGAACTGG + Intergenic
1051250808 9:15157117-15157139 AATGTCTATCTTCCGAGGAAAGG + Intergenic
1051519829 9:17973688-17973710 AGTGACTTTCTTCACAGAATTGG - Intergenic
1051799774 9:20919432-20919454 AATGACTTTCTTCACAGGATTGG + Intronic
1052883020 9:33617256-33617278 AGCGAGTTTCTTGTAAGGAAAGG - Intergenic
1054997774 9:71411715-71411737 AGTGACTTTCTTCACAGAATTGG + Intronic
1055358602 9:75464325-75464347 AGTGAGTTTAATCCAAGTAATGG - Intergenic
1055556540 9:77479546-77479568 AATGACTTTCTTCAAAGAATTGG - Intronic
1055754938 9:79548186-79548208 AATGACTTTCTTCAAAGAATTGG + Intergenic
1055767490 9:79680140-79680162 AATGACTTTCTTCAAAGAATTGG - Intronic
1056668481 9:88601938-88601960 AATGACTTTCTTCACAGGATTGG + Intergenic
1058012432 9:99993131-99993153 AGTGACTTTCTTCACAGAATTGG + Intronic
1058088689 9:100779757-100779779 AGTGACTTTCTTCACAGAATTGG + Intergenic
1058090457 9:100800149-100800171 AGTGACTTTCTTCACAGAATTGG + Intergenic
1058114557 9:101070109-101070131 AGTGAATTCCTTCCAAAGTACGG - Intronic
1058305404 9:103435113-103435135 AGTGACTTTCTTCACAGAATTGG - Intergenic
1058366281 9:104212943-104212965 ACATACTTACTTCCAAGGAAAGG - Intergenic
1058981124 9:110171642-110171664 AATGACTTTCCTCCAGGGGACGG - Exonic
1059060244 9:111028371-111028393 ATTGACTTTCTTGCTAGGCATGG - Intronic
1061508216 9:131044554-131044576 AGTGACTTGCTTCTAATGACTGG + Intronic
1202802510 9_KI270720v1_random:13126-13148 AATGACTTTCTTCACAGAAATGG - Intergenic
1203410714 Un_KI270581v1:6392-6414 AATGACTTTCTTCCCAGAATTGG + Intergenic
1186354635 X:8777563-8777585 ACTGACTTTCTTCAAAGAAATGG + Intergenic
1186577813 X:10785434-10785456 AATGACTTTCTTCAAAGAATTGG + Intronic
1186782516 X:12927366-12927388 AATGACTTTCTTCAAAGAATTGG + Intergenic
1188291969 X:28400655-28400677 AATGACTTTCTTCCCAGAATTGG + Intergenic
1188778962 X:34256373-34256395 TGTGACTTGCTTCCAACCAAAGG - Intergenic
1188906270 X:35795812-35795834 CGTGACTTTATTGCAAGAAAAGG + Intergenic
1190590246 X:51992827-51992849 AGTGACTTTCTTCACAGAATTGG - Intergenic
1190806476 X:53842773-53842795 AGAGACATTCTTCAAAGTAATGG - Intergenic
1190921315 X:54855456-54855478 AATGACTTTCTTCACAGGATTGG - Intergenic
1191003117 X:55682679-55682701 AGTGACTTTCTTCACAGAATTGG - Intergenic
1191794411 X:65005199-65005221 ATTGACTTTCTTCAAAGAATTGG + Intronic
1191964453 X:66741901-66741923 AATGACTTTCTTCAAAGAATTGG - Intergenic
1191998514 X:67122917-67122939 AATGACTTTCTTCAAAGAATTGG - Intergenic
1192010870 X:67271028-67271050 AATGACTTTCTTCAAAGTATTGG + Intergenic
1192046593 X:67681668-67681690 AGTGAGTTTCCTGGAAGGAAAGG + Intronic
1192258239 X:69484347-69484369 ACTGACTTTCTTCAAAGAATTGG - Intergenic
1192389015 X:70705319-70705341 AGTGACTTTCTTCACAGAATTGG - Intronic
1192389616 X:70712313-70712335 AGTGACTTTCTTCACAGAATTGG - Intronic
1192951330 X:76020320-76020342 AGTGACTTTCTTCACAGAATTGG + Intergenic
1193367756 X:80655185-80655207 AATGACTTTCTTCAAAGAACTGG + Intergenic
1193419496 X:81266729-81266751 ACTGACTTTCTTCAAAGAATTGG - Intronic
1193522466 X:82548061-82548083 AGTGACTTTCTTCACAGAATTGG - Intergenic
1193581181 X:83265017-83265039 AGTGACATTCTTCAAAGAACTGG + Intergenic
1193957531 X:87880583-87880605 AATGACATTCTTCAAAGAAATGG - Intergenic
1194519205 X:94897507-94897529 AGTGACTTTCTTCACAGAATTGG - Intergenic
1194633891 X:96320508-96320530 AGTGGGTTTCATCCCAGGAATGG - Intergenic
1194684735 X:96899250-96899272 AATGACTTTCTTCACAGGATTGG - Intronic
1195338994 X:103886434-103886456 AGTGACTTTCTTCACAGAATTGG - Intergenic
1196293251 X:113968382-113968404 AATGACTTTCTTCATAGAAATGG + Intergenic
1196617126 X:117779065-117779087 AATGACTTTCTTCACAGAAATGG - Intergenic
1197461648 X:126750044-126750066 AGTGAATATCTTCTAGGGAAAGG + Intergenic
1197558520 X:127988789-127988811 AGTGACTTTCTATCATGGGAAGG - Intergenic
1197991166 X:132319033-132319055 AATGACTTTCTTCACAGAAATGG + Intergenic
1198068760 X:133127212-133127234 AGTGGCTTTCTTCCCAGGGCTGG + Intergenic
1198113144 X:133520580-133520602 AGTGACTTGTTTCTAATGAATGG - Intergenic
1199154625 X:144532927-144532949 AGTGACTTTTTTCCAAAAAGTGG + Intergenic
1199534826 X:148890680-148890702 AGAGTTTTTCTTCCAAGGATTGG + Intronic
1200551431 Y:4583341-4583363 AGTGACTTTATTGGAAGAAAAGG + Intergenic
1201249874 Y:12046193-12046215 AATGACTTTCTTCTAAGAATTGG + Intergenic
1201421870 Y:13808250-13808272 ATTGACTTTCTTCAAAGAACTGG - Intergenic
1201527073 Y:14948249-14948271 AATGACTTTCTTCAAAGAATTGG - Intergenic
1201768013 Y:17590961-17590983 AGTGACTTTCTTCACAGAATTGG + Intergenic
1201778318 Y:17690878-17690900 AGTGACTTTCTTCACAGAATTGG - Intergenic
1201823238 Y:18215114-18215136 AGTGACTTTCTTCACAGAATTGG + Intergenic
1201833540 Y:18315024-18315046 AGTGACTTTCTTCACAGAATTGG - Intergenic
1202058959 Y:20866163-20866185 AATGACTTTCTTCCCAGAATTGG - Intergenic
1202070411 Y:20986071-20986093 AGTGTCTTTCTTCCAAATAGTGG + Intergenic
1202350219 Y:23981836-23981858 AGTGACTTTCTTCACAGAATTGG - Intergenic
1202520560 Y:25688285-25688307 AGTGACTTTCTTCACAGAATTGG + Intergenic