ID: 931331146

View in Genome Browser
Species Human (GRCh38)
Location 2:61285395-61285417
Sequence GAGGAACACCTGAGTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20861
Summary {0: 1, 1: 65, 2: 1111, 3: 5015, 4: 14669}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931331139_931331146 3 Left 931331139 2:61285369-61285391 CCCATCTACTTTGGAGGCTGAGA 0: 1
1: 166
2: 10128
3: 139512
4: 337397
Right 931331146 2:61285395-61285417 GAGGAACACCTGAGTCTGGGAGG 0: 1
1: 65
2: 1111
3: 5015
4: 14669
931331140_931331146 2 Left 931331140 2:61285370-61285392 CCATCTACTTTGGAGGCTGAGAA 0: 1
1: 9
2: 476
3: 12887
4: 147415
Right 931331146 2:61285395-61285417 GAGGAACACCTGAGTCTGGGAGG 0: 1
1: 65
2: 1111
3: 5015
4: 14669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931331146 Original CRISPR GAGGAACACCTGAGTCTGGG AGG Intronic
Too many off-targets to display for this crispr