ID: 931333269

View in Genome Browser
Species Human (GRCh38)
Location 2:61311248-61311270
Sequence CCTCACAGGCAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931333269_931333277 14 Left 931333269 2:61311248-61311270 CCTTCCACCCTCTGCCTGTGAGG 0: 1
1: 0
2: 5
3: 42
4: 423
Right 931333277 2:61311285-61311307 GTGCCACTTTGAAAGCAGAGAGG 0: 1
1: 1
2: 0
3: 17
4: 173
931333269_931333276 -8 Left 931333269 2:61311248-61311270 CCTTCCACCCTCTGCCTGTGAGG 0: 1
1: 0
2: 5
3: 42
4: 423
Right 931333276 2:61311263-61311285 CTGTGAGGAGGCAGCATTCAAGG 0: 1
1: 0
2: 5
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931333269 Original CRISPR CCTCACAGGCAGAGGGTGGA AGG (reversed) Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901265353 1:7905973-7905995 CTTCACAGCCAGTGGGTGGGTGG + Intergenic
901372680 1:8813689-8813711 ACTCAGAGGCAGAGGTTGCAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902478226 1:16699162-16699184 CCACACAGCTAGAGGGTGGGAGG + Intergenic
903787109 1:25868632-25868654 CCTCAGAGGCAGAGGTTGCCGGG + Intronic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904839928 1:33365862-33365884 CCTGACAGACAGAGTGGGGAAGG - Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905661447 1:39729179-39729201 ATTCACAGGCAAAGAGTGGAAGG - Intronic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
910166974 1:84338134-84338156 GGTAACAGGCAGAGGTTGGAGGG - Intronic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
911618902 1:100044589-100044611 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912748504 1:112266101-112266123 CCAGACAGTCAGATGGTGGAAGG + Intergenic
913113909 1:115679565-115679587 CATCACACTCACAGGGTGGAGGG + Intronic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
915100154 1:153493423-153493445 CCTCACACGCAAGGGCTGGAGGG - Intergenic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
916548376 1:165827799-165827821 TCGCACAGGCAGCGGGAGGAGGG + Exonic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
922623504 1:227011892-227011914 CATTAGAGGCAGAGGGTGAATGG + Intronic
922804058 1:228376779-228376801 CCTCAGAGGCTGTGGGAGGAGGG - Exonic
923641938 1:235772147-235772169 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
924806441 1:247365431-247365453 GGTAACAGGCAGAGGTTGGAGGG + Intergenic
1063013894 10:2055095-2055117 CATAACAGGCTGATGGTGGAAGG + Intergenic
1063660026 10:8028931-8028953 CCTGAGAGGCAGAGGTTGCAAGG - Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067842479 10:49691900-49691922 CCTCACAGGTGGAGGTTGGGGGG + Intronic
1068247367 10:54390366-54390388 CCCCAGAGGCAGAGGTTGCAGGG - Intronic
1069160227 10:65083908-65083930 CAGCACCGGCAGAGGGTGGTAGG + Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1070276304 10:75010720-75010742 CCCCACAGACCGATGGTGGAGGG - Intronic
1070630435 10:78080936-78080958 CCCCACAGGCAGAGAGGAGAAGG + Intergenic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1071991312 10:91103138-91103160 GCCCCAAGGCAGAGGGTGGAGGG + Intergenic
1072001711 10:91201588-91201610 CCTCAGGGGCTGTGGGTGGAGGG - Intronic
1073026501 10:100490722-100490744 GCTCAAAGGCAAAGGCTGGATGG + Exonic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1076667743 10:132102656-132102678 CCTCACAGAGGGAGGGTGAAAGG - Intergenic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077238913 11:1500562-1500584 CCTCTGAGGCAGTGGGAGGATGG - Intronic
1077282190 11:1750851-1750873 GCCCACAGGCCGTGGGTGGATGG + Intronic
1077315732 11:1918634-1918656 CCCCACAGGCTGAGCGTGGGCGG - Intergenic
1077530954 11:3094511-3094533 CCCCACAGGGAGAGGCTGGTGGG + Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081595101 11:44453518-44453540 CCTCACAGACAGAGGGCAGCAGG - Intergenic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1081871088 11:46382793-46382815 CCTCACAGGCGGGGGGGGGGGGG - Intronic
1081937380 11:46914563-46914585 CCTCACAGGCTGAGGAGGGGAGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1086723396 11:90149508-90149530 CCTCGGAGGCAGAGGTTGCAGGG - Intronic
1088261458 11:107948072-107948094 CCTCCCAGGAAGATGGTGAAGGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090116522 11:123979489-123979511 CAGCACTGGCAGAGGGTGGGAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1095498557 12:42811672-42811694 CCTTACAGCCTGAGGGAGGAGGG + Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1103449557 12:121018792-121018814 CCTCGGAGGCAGAGGTTGCAGGG + Intergenic
1103823580 12:123717998-123718020 CCCGAGAGGCAGAGGTTGGATGG - Intronic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1104748012 12:131221920-131221942 CCTCGCTGGCAGAGGGCAGAGGG + Intergenic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1104886270 12:132110791-132110813 TCCCACAGGAAGAGTGTGGAGGG + Intronic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1108523025 13:51261813-51261835 ACTCACAGGCACAGAGTGGTTGG - Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108981893 13:56524405-56524427 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
1111601723 13:90482618-90482640 GATAACAGGCAGAGGTTGGAGGG - Intergenic
1112033400 13:95476633-95476655 CCTCCCAGGCAGTGTGTGAAGGG + Intronic
1112517498 13:100067295-100067317 CCTCAGAGACAGAGGTTGCAGGG + Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1113735639 13:112677255-112677277 CATCACAGGCAGAGATTGAATGG + Intronic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1117434517 14:55703343-55703365 AATCACAGGCTGAGGATGGAGGG + Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118866830 14:69711021-69711043 TCCCACAGGGAGAGGGAGGAAGG - Exonic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121794579 14:96724451-96724473 TTCCACAGGCAGAGGGTTGAAGG - Intergenic
1122114259 14:99520053-99520075 CCTGACAGCCAGTGGATGGAGGG + Intronic
1122129433 14:99596584-99596606 CCTCACAGGCAGAGGGTTCTGGG - Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1123072998 14:105651268-105651290 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123092922 14:105750037-105750059 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1124945567 15:34262514-34262536 CTCCACTGGCAGAGCGTGGAGGG - Intronic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1131978440 15:97970650-97970672 CCTCACAGTTAGGGGGTTGAGGG - Exonic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132883057 16:2170822-2170844 GCTCACAGGGAGAGGGCGGCTGG + Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136392685 16:29975179-29975201 CATCACAGCAAGAGGTTGGAAGG - Intronic
1137556074 16:49471169-49471191 CCTCACAGGCATTGAGTGTAGGG + Intergenic
1138457296 16:57128749-57128771 CCACACAGCGAGAGGATGGAGGG - Intronic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142262487 16:89049513-89049535 CCTCACAGGCCCAGGGAGGAGGG - Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145966857 17:28925294-28925316 CCTCTCAGGGATATGGTGGAGGG + Intronic
1146461233 17:33047444-33047466 CCTCAGAGGCTGAGGTGGGAGGG - Intronic
1148132496 17:45270537-45270559 CCTCACAGGCGGAGGCTCGCTGG + Exonic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152255663 17:79238010-79238032 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1152768477 17:82153491-82153513 CCCCACAGGCAAAGGAAGGAGGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1153882741 18:9434890-9434912 CCCCAGAGGCAGAGGTTGCAGGG + Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1157021208 18:43784407-43784429 GCACAGAGGCAGAGGGTGGTGGG + Intergenic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1160418916 18:78731062-78731084 CCTCACAGACAGGCGGTGGGAGG - Intergenic
1160737070 19:667774-667796 CCTGCCAGGATGAGGGTGGAGGG - Intergenic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1161138805 19:2636204-2636226 CCTCCCACTCAGGGGGTGGATGG + Intronic
1161340591 19:3739850-3739872 CCTCACAAGAAGAGGCGGGAGGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1163079425 19:14926589-14926611 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1163681478 19:18684677-18684699 CCTCTCAGGACCAGGGTGGAGGG + Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1166071946 19:40393086-40393108 CCTCACCGGCAGAGGGCAGGTGG + Intergenic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1167646728 19:50710085-50710107 CCCCACAGGCAGATGGGGGTGGG - Intronic
1168257030 19:55172845-55172867 CCTCACAGCCAGCGTGTGGCAGG + Exonic
1202712247 1_KI270714v1_random:24990-25012 CCACACAGCTAGAGGGTGGGAGG + Intergenic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926010109 2:9400462-9400484 TCTCAGAGGCCGAGGGAGGAGGG - Intronic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
926890252 2:17633441-17633463 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927701328 2:25270654-25270676 CAACACTGGCAGAGGGTGGGGGG + Intronic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929963596 2:46515808-46515830 ACACACAGGCTGAGGGTGAAAGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930089599 2:47521856-47521878 CCTCACTGGGCGAGGGTGGGGGG + Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
933357346 2:81228649-81228671 CCTCAGAGTCTGAGGCTGGAGGG + Intergenic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
933906731 2:86901401-86901423 CCACACAGGCACAGGCAGGAAGG + Intergenic
933967863 2:87444681-87444703 CCTCACTGGCTGAGGGTGCTGGG + Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
934708272 2:96499699-96499721 CCACTCAGGCAGCGGCTGGAGGG - Intronic
935775819 2:106470310-106470332 CCACACAGGCACAGGCAGGAAGG - Intergenic
936325935 2:111505818-111505840 CCTCACTGGCTGAGGGTGCTGGG - Intergenic
936365431 2:111850270-111850292 CCACACAGGCACAGGCAGGAAGG - Intronic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
938004725 2:127779388-127779410 ACTCAGAGGCAGAGGTTGCAGGG + Intronic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
939982678 2:148799715-148799737 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
942218628 2:173747261-173747283 CCAACCAGGCAGATGGTGGATGG - Intergenic
942846257 2:180429341-180429363 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
943563913 2:189495419-189495441 AGTAACAGGCAGAGGTTGGAAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
943921608 2:193713730-193713752 TTTCAGAGGCAGAGGGTGGGGGG - Intergenic
945110127 2:206354948-206354970 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946195851 2:218032789-218032811 CCCCACAGACAGAGGAGGGAGGG + Intergenic
946429094 2:219615129-219615151 TCTAACAGGAACAGGGTGGACGG - Exonic
947271896 2:228345671-228345693 CCCCAGAGGCAGAGGTTGCAAGG - Intergenic
947519137 2:230830315-230830337 CCTCACTGTGTGAGGGTGGAAGG - Intergenic
947888417 2:233594666-233594688 GATAACAGGCAGAGGTTGGAAGG + Intergenic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
948308159 2:236965339-236965361 CTGCACAGGCAGTGGGTGTACGG + Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1169146629 20:3256835-3256857 CCTCAGAGGCCAAGGGAGGAGGG + Intronic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1170822724 20:19767847-19767869 CCTGAGAGGCAGAGGTTGCAGGG + Intergenic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171317236 20:24205956-24205978 CCCCACAAGCAGGTGGTGGAAGG + Intergenic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1173331246 20:42077964-42077986 CCAGACAGGATGAGGGTGGAGGG - Exonic
1174161142 20:48551274-48551296 CCTCAGAGCCTGTGGGTGGAGGG - Intergenic
1174315650 20:49698737-49698759 CAACACAGGCACAGGGTGGCAGG - Intronic
1174315920 20:49701557-49701579 CAACACAGGCACAGGGTGGCAGG - Intronic
1175089919 20:56493975-56493997 TCCCACAGGCACAGGGAGGAGGG - Intronic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175634643 20:60570158-60570180 TCTCAAAGGCAAAGGTTGGAAGG + Intergenic
1175904709 20:62374025-62374047 CCTCCCGGGCAGAGGGCGCAAGG - Intergenic
1176358100 21:5969542-5969564 CATCACAGGCCAAGGGTGGCAGG + Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1178664302 21:34533320-34533342 CCTAACAGGCAGAGTGAGAATGG - Intronic
1178818279 21:35951523-35951545 CAGCACAGACATAGGGTGGAAGG - Intronic
1179370784 21:40804487-40804509 GCTAGCAGGCAGAGGGTGGTAGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179765418 21:43569009-43569031 CATCACAGGCCAAGGGTGGCAGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181061379 22:20283674-20283696 CCTGAAAGGCGGATGGTGGAAGG - Intergenic
1181098750 22:20524560-20524582 CCCCACAGTCAGAGTATGGATGG - Intronic
1181620601 22:24088530-24088552 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1181781582 22:25197658-25197680 TCCCACAGCCAGAGGGTGGCAGG - Intergenic
1182546936 22:31081945-31081967 CCTAACAGGCAGAGATTGGGAGG + Intronic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1185010381 22:48309493-48309515 ACGCCCAGGCCGAGGGTGGATGG + Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185281521 22:49971929-49971951 CCCCACAGCCAGACGCTGGACGG - Intergenic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
951476397 3:23110971-23110993 TCCCACAGGCATAGGGTGCACGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
953781262 3:45872776-45872798 CCTCTCAGGCTGATGGGGGAGGG + Intronic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955405735 3:58624636-58624658 CCACACTGGCAGGGGATGGAAGG - Intronic
955456587 3:59128414-59128436 CCTCACAGGCTTAGGGTCAAGGG - Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
958812259 3:98874781-98874803 CCTCACATGACGAGGTTGGAGGG - Intronic
959393066 3:105800681-105800703 GCTCACAGGAAGTGGGTGGGGGG - Intronic
959584819 3:108016121-108016143 CATCACAGGAAGAGAGGGGATGG - Intergenic
960621940 3:119645649-119645671 CTTCACAGGCATAGAATGGAGGG + Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961190131 3:124953456-124953478 CCTCACAGGCATGGTGGGGAGGG - Intronic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963948108 3:151168779-151168801 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
964987813 3:162766157-162766179 CTCCACAGGCAGAGGGCAGAGGG + Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968150862 3:196335640-196335662 CCTGTCAGCCAGAGGGTTGATGG - Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG + Intronic
968572510 4:1349471-1349493 CCCCACACGCAGAGGATGGGCGG - Intronic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
969210597 4:5684349-5684371 CCTCGCAGCCTCAGGGTGGAAGG + Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
973857944 4:55032415-55032437 CCTCACCGGCAGAGCTGGGATGG + Intergenic
976493154 4:85694652-85694674 ACACACACACAGAGGGTGGAGGG - Intronic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
984501623 4:180565749-180565771 CCACACAGGCCGAGGGAGAAGGG - Intergenic
985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG + Intergenic
985065690 4:186118820-186118842 CCTCCCAGGCAGTGGGTGCTTGG - Intronic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
985875801 5:2592958-2592980 CCTCACAGGAATACGGCGGAGGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
988879754 5:35488462-35488484 CTTCAAAGTCAGAGGGTGAAGGG - Intergenic
991691343 5:69227863-69227885 ACTCACAGGCTGAGGTGGGATGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992597612 5:78361301-78361323 CCTAACAGAAAGAGGGGGGATGG - Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993845618 5:92939567-92939589 CCTGACTGCCAGTGGGTGGATGG + Intergenic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
995605082 5:113845520-113845542 CCTCAAAGGCACAGGGCTGAAGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996594348 5:125184474-125184496 CCTCGCAGGTGGGGGGTGGAAGG - Intergenic
997042084 5:130268678-130268700 CATCACAGGAAGTGGGTAGAAGG - Intergenic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
997962246 5:138331503-138331525 CCCCACAGACAGAGGTTGGGAGG - Intronic
998133082 5:139660866-139660888 CCTCCCAGCCAGTGGGTGGGTGG - Intronic
998136671 5:139677697-139677719 CCTCAGAGGCTGGGGGTGGGTGG + Intronic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
999331202 5:150674517-150674539 CCTCACAGGAACAGGCTGGGTGG - Intronic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1000930485 5:167245266-167245288 CCTCCCAGACAAAGGGTGCACGG + Intergenic
1001462024 5:171924624-171924646 TGGCACCGGCAGAGGGTGGAGGG - Intronic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001834959 5:174824111-174824133 CCTCAGAGCCTGTGGGTGGAGGG + Intergenic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1001963686 5:175895484-175895506 CCTCACACGGACAGGCTGGAAGG + Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004706992 6:18133926-18133948 CTACACAGGCAAAGGCTGGAGGG + Intronic
1005115059 6:22327012-22327034 CCTCACAGGAGGTGGATGGAAGG - Intergenic
1009868992 6:69432696-69432718 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1009869047 6:69432882-69432904 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1012391367 6:98744475-98744497 CCTAACAGTCAGAAGGTGGCTGG - Intergenic
1012865816 6:104616670-104616692 ACTCTCAGGCAGTGGGAGGATGG - Intergenic
1013308131 6:108868979-108869001 CCTTACAGTCGGAGGGAGGAAGG - Exonic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1014988791 6:128048141-128048163 AATCACTGGCAGAGGGTGAATGG + Intronic
1015986574 6:138890350-138890372 CCTCAAAGGCACAGGGTAGCAGG + Intronic
1016642375 6:146363929-146363951 TCTCACTGGCAGTGGTTGGAAGG + Intronic
1016894081 6:149035680-149035702 CCCCAGAGGCAGAGGTTGCAGGG + Intronic
1017765510 6:157603836-157603858 CGCCACAGGCAGAGGTTGTAAGG - Intronic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018244485 6:161809247-161809269 CCTCAAAGGCAGGGGGGGAAGGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018758576 6:166870921-166870943 GCGCCCAGTCAGAGGGTGGAAGG + Intronic
1018836950 6:167492327-167492349 TCTCTCAGGCAGTGGGAGGATGG + Intergenic
1018858340 6:167691653-167691675 CTTCACAGGCAGTGGGCGTATGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019028835 6:168993426-168993448 CCCAACAGGCAGAGGCTGCAGGG - Intergenic
1019424574 7:968276-968298 ACCCACAGGCAGAGGGACGAGGG + Exonic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1020352391 7:7235351-7235373 CCTCTCAAGCAGAGGTTGAATGG + Intronic
1020819053 7:12943030-12943052 CCACAAAGACAGTGGGTGGATGG - Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1021750474 7:23794556-23794578 CGTCATGGGCAGAGGTTGGAGGG + Intronic
1023562711 7:41492471-41492493 CCTCACAGGGAGTGGTGGGAAGG + Intergenic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024539961 7:50468138-50468160 CCTCGCGGGCAGGGGGTGGCTGG + Intronic
1026664434 7:72330215-72330237 CCTCAGAGGTGGAGGGTGCAGGG + Intronic
1026983904 7:74542814-74542836 ACTCACAGCCAGAGGCTGGGTGG + Intronic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1027624650 7:80531298-80531320 GGTAACAGGCAGAGGTTGGAAGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1034540083 7:151752398-151752420 CTTAAGAGGCAGAGGGTGGGAGG + Intronic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037449633 8:19003733-19003755 CCACACTGGCAGGGGGTGGGGGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039789942 8:40867512-40867534 ACGAAGAGGCAGAGGGTGGAGGG - Intronic
1039925957 8:41932680-41932702 CCTCACACGCAGAGATTGCAAGG - Exonic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045249976 8:100475023-100475045 CCTCACTGACAGAGATTGGAGGG + Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1047197557 8:122735237-122735259 ACACACAGGGAGAGGGAGGAAGG - Intergenic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1048278551 8:133087425-133087447 CCTCACACCCCGAGGGAGGAAGG - Intronic
1049235846 8:141511888-141511910 CCCCGGAGGCAGAGGTTGGAGGG + Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049529753 8:143148340-143148362 CCTGACGGGCATGGGGTGGATGG - Intergenic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1050575007 9:6985764-6985786 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1051076033 9:13237327-13237349 ACTCAGAGGCTGAGGTTGGAGGG + Intronic
1053421878 9:37984866-37984888 CCTCAGAGGCTGAGGGTGAGTGG + Intronic
1055052825 9:71996854-71996876 CCTGAGAGGCAGAGGTTGTATGG + Intergenic
1055736574 9:79336876-79336898 CCTCACAGGCCTAGGGTGGGAGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057813852 9:98279512-98279534 CCGCTCAGGTAAAGGGTGGAGGG - Intergenic
1057964196 9:99487599-99487621 GCTGACCGGCACAGGGTGGAAGG - Intergenic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059522381 9:114955752-114955774 CCTCTCAGACAAAGGGTTGAGGG - Intergenic
1060032899 9:120231001-120231023 ACCCACAGGCACAGTGTGGATGG - Intergenic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061486244 9:130921974-130921996 CCGCACAGGCGGCCGGTGGAGGG - Intronic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062181170 9:135192020-135192042 CCCCACACACAGAGGATGGAGGG + Intergenic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1185506554 X:635509-635531 CCCCACAGCCGGAGGGAGGAGGG - Intronic
1185921119 X:4093958-4093980 CCTGACAGGCAAAGGTTGCAGGG + Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186896917 X:14012837-14012859 CCTCCCAGGCAGAGGGGCTATGG + Intronic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1190334448 X:49253850-49253872 CCTGACAGGCTCTGGGTGGAGGG - Intronic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1191764870 X:64686862-64686884 TATCAGAGTCAGAGGGTGGAGGG + Intergenic
1194147128 X:90278726-90278748 CCTCACAGACAGAGGGTACAAGG - Intergenic
1195575003 X:106439605-106439627 ATTCACAGAAAGAGGGTGGAGGG - Intergenic
1197675216 X:129322604-129322626 CTTCACAGCCAGATGGTTGAGGG - Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1199993725 X:153005598-153005620 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
1200493531 Y:3855494-3855516 CCTCACAGACAGAGGGTACAAGG - Intergenic