ID: 931333320

View in Genome Browser
Species Human (GRCh38)
Location 2:61311875-61311897
Sequence CTGAGACAGTGGCAAATTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931333320_931333323 22 Left 931333320 2:61311875-61311897 CCTTCAATTTGCCACTGTCTCAG 0: 1
1: 0
2: 0
3: 14
4: 207
Right 931333323 2:61311920-61311942 GACACAAACAACACATAGAAAGG 0: 1
1: 1
2: 1
3: 29
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931333320 Original CRISPR CTGAGACAGTGGCAAATTGA AGG (reversed) Exonic
900034254 1:393745-393767 GTGGGACAGTAGCAATTTGAAGG - Intergenic
900055089 1:623635-623657 GTGGGACAGTAGCAATTTGAAGG - Intergenic
904615000 1:31744780-31744802 CTGTTACAGTGGCACAGTGAAGG + Intronic
906664759 1:47612626-47612648 CCAAACCAGTGGCAAATTGATGG + Intergenic
907738705 1:57141730-57141752 CGGAGACGGTGGCAAAATGGTGG - Intronic
907743675 1:57191436-57191458 ATGAGACAGTGGTAAAGGGAAGG - Intronic
908037908 1:60075395-60075417 CTGACACAGTGAGAAATGGAAGG - Intergenic
908776404 1:67645247-67645269 TTAAGCCAGTTGCAAATTGATGG + Intergenic
910407760 1:86908261-86908283 CTGAGACAAAAGCAAATAGATGG + Intronic
910463785 1:87475108-87475130 CTGAGAAGATGGTAAATTGAGGG + Intergenic
912102345 1:106225627-106225649 CTGACACAGTGATAAATTGCTGG - Intergenic
914358509 1:146909573-146909595 CTGAGAAGATGGTAAATTGAGGG + Intergenic
914494916 1:148187434-148187456 CTGAGAAGATGGTAAATTGAGGG - Intergenic
915290621 1:154880709-154880731 GAGAGACAGTGGTAGATTGAAGG - Intergenic
915848574 1:159296467-159296489 CTGAAACAGTGAAAAATTCAAGG + Intronic
917230202 1:172828256-172828278 CTGAGGGACTGGCAAATTGGGGG + Intergenic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
921266479 1:213424913-213424935 CTGGGACAGAGGCAAGCTGAGGG - Intergenic
922256610 1:223897914-223897936 GTGGGACAGTAGCAATTTGAAGG - Intergenic
1062790067 10:298003-298025 CTGAGACTGGGGCATATTGTAGG - Intronic
1063055743 10:2502293-2502315 CAGAAACATTGGCCAATTGAGGG - Intergenic
1063582200 10:7318146-7318168 AAGAGAAAGTGGCAAATTCATGG + Intronic
1067760929 10:49046247-49046269 CTCAGAGAGTACCAAATTGAGGG + Intronic
1068206351 10:53859553-53859575 AAGAGACAGTGGAAAATTCAAGG - Intronic
1071813958 10:89212395-89212417 CTGAGCCAGTTGGAATTTGATGG - Intergenic
1071979344 10:90987930-90987952 CTGGGACAATAGCAAATGGATGG - Intergenic
1072978692 10:100081234-100081256 CAGAGGCAGTGGCAGTTTGAGGG + Intronic
1076092456 10:127699618-127699640 CAGAGACAGTGGCCCATGGAGGG - Intergenic
1076229799 10:128810752-128810774 CTGGGAAAGTGGCAAATTTTAGG - Intergenic
1076425509 10:130364648-130364670 CAGAGAAAGTGGCAACGTGAAGG + Intergenic
1080199039 11:29647051-29647073 CAGATACATTGGCAAATTGTTGG + Intergenic
1083060113 11:59861002-59861024 CTGACACAGTGGGAAATTTCTGG + Intronic
1083773440 11:64880913-64880935 CTGAGCCCATGGCAGATTGATGG + Intronic
1084207032 11:67601199-67601221 CTGAGACCCTGGCAGAGTGATGG + Intergenic
1084439215 11:69161685-69161707 CGGAGACAGTGAAGAATTGATGG + Intergenic
1087866505 11:103234251-103234273 CTGAGCCAGGTGCAAATTAATGG - Intronic
1087904969 11:103684942-103684964 GTGAGAAAGAGGCAAATTTAAGG - Intergenic
1088872520 11:113903210-113903232 ATGAGACAGTGGCATACTGTGGG - Intergenic
1089133517 11:116231136-116231158 CTCAGACAATGGCAACTGGAAGG + Intergenic
1089175275 11:116544508-116544530 CTAATACAGTGGCTAAATGATGG + Intergenic
1089365387 11:117918207-117918229 CTGAGACAGTGGAAAATGAGGGG - Intronic
1095218221 12:39575998-39576020 CTGATACAGTGACAAATTTATGG + Intronic
1095378781 12:41563989-41564011 TTAAGTAAGTGGCAAATTGAAGG - Intronic
1095816817 12:46431641-46431663 ATTAGACAGTGGAAAATTTAAGG - Intergenic
1095852140 12:46822341-46822363 CTGAGACAGAAACAAATAGAAGG - Intronic
1096581005 12:52585214-52585236 GTGAGACAGTGGGAGAATGAAGG + Intergenic
1097179259 12:57161838-57161860 CTGAGACAGTGGGAAGCTCAAGG + Intronic
1097399483 12:59111879-59111901 CTTAGACAGTGGGATATTGCAGG + Intergenic
1098432858 12:70439346-70439368 CTGACACAGTGCCATATTTATGG + Intergenic
1099101376 12:78445447-78445469 CTGAAGCAGTGGTAACTTGATGG - Intergenic
1102130694 12:110526411-110526433 CTAAGCCAGTAGCAAATTCAGGG + Intronic
1104973830 12:132543239-132543261 CAGAGACAGTGGCACCTTCATGG - Intronic
1106086623 13:26548406-26548428 CTGAGAAAGCGGCAAAGAGAAGG - Intergenic
1108430453 13:50348025-50348047 CTGAGACTGCAGAAAATTGATGG + Intronic
1109070978 13:57767869-57767891 TTGAGACAGAGGCAAAAGGACGG + Intergenic
1112832100 13:103465573-103465595 CAGAGACAGTTGCAAATCCATGG - Intergenic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1114592986 14:23885720-23885742 TTGAGACAGTTGCAACTTAAAGG + Intergenic
1116295340 14:43100291-43100313 CTGAGACCGTGGCAACTACAGGG + Intergenic
1117155416 14:52935333-52935355 CTGAGGCAGTGTCAAATTATGGG + Intronic
1117627907 14:57659101-57659123 CTGAGAAAGTAGAAAACTGAAGG - Intronic
1120316334 14:82898270-82898292 CTGACTCAGTGCCAAGTTGATGG - Intergenic
1121146669 14:91589980-91590002 CTGAAAGAGTGGCAAAAGGAGGG - Intronic
1121172910 14:91869271-91869293 CTGTGACTCTGGCAAATTGATGG - Intergenic
1123435578 15:20251677-20251699 CTGTGACAGTGACAGAATGAGGG - Intergenic
1125331595 15:38588050-38588072 CTGAGAGCAAGGCAAATTGAGGG - Intergenic
1126666726 15:51081869-51081891 TTGAGACAGGAGCAAATTGTTGG - Intronic
1127921738 15:63500112-63500134 CTGATACTGTGGCAACTTGTTGG - Intergenic
1128030879 15:64479118-64479140 CTGACACAGTGGGAAGTTCAAGG + Intronic
1128079654 15:64848776-64848798 CTGGGACAGGGGCAAAGTGAGGG + Intronic
1128634581 15:69294829-69294851 CTGACACAGTGAGAAGTTGAGGG + Intergenic
1129888899 15:79058083-79058105 CTGAGGCACAGGCACATTGAGGG + Intronic
1130686646 15:86043393-86043415 CTGAGACAAAGGCCAATGGAGGG - Intergenic
1131454463 15:92572247-92572269 CTGAGTCAGTGGGAATGTGATGG + Intergenic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1132007028 15:98236545-98236567 TTCAGACAGTGGACAATTGAGGG - Intergenic
1134003963 16:10804969-10804991 CCGAGACAGAGGCAGATTGGTGG - Intronic
1136714433 16:32265611-32265633 CTGAGACAAAGACAAACTGACGG + Intergenic
1136753456 16:32663806-32663828 CTGAGACAAAGACAAACTGACGG - Intergenic
1136814657 16:33206559-33206581 CTGAGACAAAGACAAACTGACGG + Intronic
1136821133 16:33316639-33316661 CTGAGACAAAGACAAACTGACGG + Intergenic
1136827696 16:33373178-33373200 CTGAGACAAAGACAAACTGACGG + Intergenic
1136832762 16:33471949-33471971 CTGAGACAAAGACAAACTGACGG + Intergenic
1138132306 16:54490952-54490974 CTGAGCCAGTCGCAAATGTATGG - Intergenic
1140323993 16:73982272-73982294 CAGAGACAGTAGCAGATTCAAGG + Intergenic
1202993233 16_KI270728v1_random:29533-29555 CTGAGACAAAGACAAACTGACGG + Intergenic
1203055617 16_KI270728v1_random:924158-924180 CTGAGACAAAGACAAACTGACGG - Intergenic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1144109365 17:12017392-12017414 CTGAGCCCTTGGCAATTTGAGGG + Intergenic
1148044870 17:44737249-44737271 CTGACAAACTGGCAGATTGATGG + Intronic
1148796293 17:50198671-50198693 ATGAGACAATCCCAAATTGAGGG + Intronic
1151077402 17:71289163-71289185 CTGAGAAAGAGGCACTTTGAGGG - Intergenic
1153372825 18:4338975-4338997 CTGAGACTGTGTCCAACTGATGG + Intronic
1161861696 19:6802664-6802686 CTTAGAGAGTGGCATAATGAGGG - Intronic
1163588448 19:18176769-18176791 CTGAGAGAGTGGCAAGGAGAGGG + Intronic
925738224 2:6982705-6982727 TTGAGAAAGTGGCAACTTCATGG + Intronic
929539180 2:42806771-42806793 CTCAGACACTGACAAATGGAGGG + Intergenic
930459161 2:51648769-51648791 CTGGGACAGTGGCTAATTGTGGG - Intergenic
931333320 2:61311875-61311897 CTGAGACAGTGGCAAATTGAAGG - Exonic
932770244 2:74497088-74497110 CTGGGACACAGGCAAATAGACGG - Intergenic
933034359 2:77374021-77374043 CTTAGCCAGTGGAAAAGTGAAGG - Intronic
933087566 2:78075244-78075266 CTGAAACAGAGTCAAAGTGAAGG + Intergenic
933155391 2:78967482-78967504 CTGACACCGTGGCAAAGAGAAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936471590 2:112803388-112803410 GTGAGACTGTGGAAAAGTGAGGG + Intergenic
936978221 2:118240227-118240249 CTGAGACAGAGGTAAACAGAAGG + Intergenic
938173147 2:129100875-129100897 CAGAGACTGTGGGAATTTGAAGG - Intergenic
938208789 2:129446969-129446991 CTGAGACAGTTTCAAAGTCATGG + Intergenic
938973616 2:136454993-136455015 ATGAGACAAAGGCAAATTGAGGG - Intergenic
939095192 2:137826349-137826371 CTGAAACTGTGGCACAATGAAGG - Intergenic
939827280 2:147029998-147030020 CTGAGAAAATTGAAAATTGAGGG + Intergenic
940684249 2:156826497-156826519 CTGGGACAGTGGCCAATACAAGG - Intergenic
940777804 2:157902921-157902943 CTGGGGCAGTGGCAAATTGTAGG - Intronic
941392745 2:164935096-164935118 CCGAGACAGTGCCAAAGTAACGG - Intronic
942770075 2:179506314-179506336 GTGAGACAGTGGCAACTGTAAGG + Intronic
945042202 2:205751850-205751872 CGGAGACAGTGGAAAAATGTTGG - Intronic
948267712 2:236647856-236647878 GTGAGGCATTGGCAAATTGTAGG - Intergenic
1170058826 20:12237981-12238003 CTGAGTCAGTGTCAAATTGGTGG + Intergenic
1171998945 20:31756492-31756514 ATGAGAAAATGGTAAATTGAGGG + Intronic
1172314044 20:33939854-33939876 CTGAGCCACTGGGAAAGTGAGGG - Intergenic
1172895010 20:38294324-38294346 CTGGGACAGTGGCCGTTTGATGG + Intronic
1172968496 20:38856345-38856367 CTAAGGAAGTGGCAAAATGAAGG - Intronic
1175056896 20:56206824-56206846 TTGAGAAAGTGGCTTATTGAGGG - Intergenic
1175438872 20:58976578-58976600 CTAAGACAGTGGCATAACGATGG + Intergenic
1177203805 21:17987945-17987967 CTGAGAAAGGCACAAATTGAGGG + Intronic
1179311244 21:40198065-40198087 CTGAGAAAGTGGAAATTTCAAGG - Intronic
1179598874 21:42462236-42462258 CTGAGTCAGTTGCAAATAGTAGG - Intergenic
1185132339 22:49046386-49046408 CTCAGACAGTGACATTTTGAGGG + Intergenic
951152375 3:19306648-19306670 CTGGCACAGAGGCAAATTGGTGG + Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953050273 3:39335393-39335415 CTGAGGCAGTGGCAAAAAAAAGG + Intergenic
955842605 3:63128271-63128293 CACAGGCAGTGGCAAATGGAAGG + Intergenic
956145104 3:66184115-66184137 GAGAGACAGTGGCAGATTCAGGG - Intronic
958475516 3:94575942-94575964 GTGAGACAGAGACAAATTGAGGG - Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
960756102 3:121014696-121014718 CTGAAACAGTGACATATTGCTGG - Intronic
960878238 3:122318032-122318054 ACGAGACAGTGGCAAAAAGAGGG + Intergenic
968015011 3:195321921-195321943 CATAGACAGTGTCAGATTGAAGG - Intronic
970066679 4:12102890-12102912 CTTAGACAGTGGCAAAACAAGGG - Intergenic
970289075 4:14552071-14552093 CTGCGAGAGAGGCAAATGGAGGG + Intergenic
971504009 4:27347083-27347105 CTGACACAGGGGAAAATGGAAGG - Intergenic
977588202 4:98798884-98798906 CTGGGACAATGGGGAATTGAAGG - Intergenic
978448276 4:108801897-108801919 GAGAGATAGTGGCATATTGATGG + Intergenic
979239324 4:118434543-118434565 GTGGGACAGTAGCAATTTGAAGG + Intergenic
981371532 4:143964360-143964382 CTGAGAGGGAGGAAAATTGAGGG + Intergenic
982359629 4:154505582-154505604 CTAAGAGAGTGGGAAAATGAGGG - Intergenic
983386817 4:167074459-167074481 CTGAGCCAGTGAGAAACTGAAGG - Intronic
984219213 4:176952895-176952917 CTATGTCAGTGGCAAATTGTAGG - Intergenic
986615564 5:9613747-9613769 CTGAGAGATTGGAAAATTAAAGG + Intergenic
988376807 5:30446863-30446885 ATTAGACAGTGACAATTTGAAGG - Intergenic
989232793 5:39104965-39104987 TTGAGACAGTGGCACAATCATGG + Intergenic
989705947 5:44330483-44330505 CTGAAACAGAGGCAAATTGCTGG - Intronic
996549948 5:124719836-124719858 CTGACCCAGTGGCAAATTCAAGG + Intronic
996868729 5:128160811-128160833 CTTATACAGTGGCAAAGTCAAGG + Intronic
998621436 5:143798671-143798693 ATGTGATACTGGCAAATTGAAGG - Intergenic
999614601 5:153408917-153408939 ATGAGACAAAGCCAAATTGAGGG + Intergenic
999649785 5:153754222-153754244 CTGAGCCAGTTCCAAATTGAAGG + Intronic
1001370755 5:171198384-171198406 CTGAAACAATGTGAAATTGAAGG + Intronic
1002739566 5:181425123-181425145 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1003926123 6:10879578-10879600 CTGAGACTAAGGCAAATTCAAGG + Intronic
1004249871 6:14015042-14015064 CTAAGATAGTGGCAAATAGGTGG - Intergenic
1004758791 6:18642793-18642815 GGGAGACACTGGTAAATTGAAGG + Intergenic
1004935694 6:20506093-20506115 CTGAGAGAGTAACAAAGTGAGGG - Intergenic
1005103020 6:22194056-22194078 CTGAAACAGTGGCCCATGGATGG - Intergenic
1006715815 6:36119628-36119650 CTGGGACAGAGGCAAAATCAGGG - Intergenic
1007367066 6:41402127-41402149 CTGAGAAATAGGCAAAATGAAGG - Intergenic
1009059386 6:58380014-58380036 CTTAGACATTGTCAAATGGAGGG - Intergenic
1010747850 6:79584483-79584505 CTCAGACACTGCCAAATGGAGGG - Intergenic
1012120016 6:95354738-95354760 CTGCGACAGTGGCAAACAGCAGG - Intergenic
1014162441 6:118185728-118185750 CAGAGACTGTGGCCAAGTGAAGG - Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015137850 6:129893979-129894001 ATGAGACAGTGCAAAATAGATGG + Intergenic
1015407045 6:132849552-132849574 ATGAGACAGTGTCCAATGGAGGG - Intergenic
1017432541 6:154385267-154385289 CTGGAACACTGGCAAAATGAAGG - Intronic
1019244683 6:170700710-170700732 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1020575810 7:9925918-9925940 CAGAGACTGTGGGAAATGGAAGG - Intergenic
1021587428 7:22224236-22224258 CTGAGACAATGGTAAATATATGG + Intronic
1023288463 7:38643933-38643955 CTGAGACAGAGTCTAATGGATGG + Intergenic
1024980338 7:55152840-55152862 CTGAGACCTTGGGAAAATGATGG + Intronic
1029799865 7:102935141-102935163 CTGAGACAGAGTGAAAGTGATGG + Intronic
1029895210 7:103976454-103976476 CTGAGGCAATGGCAAATTCTGGG + Intronic
1032697575 7:134350614-134350636 CTGACCCAGTGGCAAATTTCAGG + Intergenic
1034862073 7:154606137-154606159 ATAAGCCAGTGGCCAATTGAAGG - Intronic
1034956424 7:155338213-155338235 CTGGGACAGAGGCACATTTACGG + Intergenic
1034956497 7:155338543-155338565 CTGGGACAGAGGCACATTTACGG + Intergenic
1035168237 7:157003993-157004015 CTGAGAAAGTGACAAACAGAAGG + Intronic
1035503444 8:107478-107500 GTGGGACAGTAGCAATTTGAAGG - Intergenic
1036275958 8:7352137-7352159 CTGAGACCATGGCAAGATGAGGG - Intergenic
1038540158 8:28385297-28385319 CTGAGTCAGTTCCAAAGTGAAGG + Intronic
1038927360 8:32155343-32155365 CTGAGTCAGCAGAAAATTGAAGG - Intronic
1039855385 8:41407689-41407711 CAGAGACTGTGGAGAATTGATGG - Intergenic
1040692299 8:49953678-49953700 CTGAGACACTGGAAATTTGCTGG + Intronic
1046047241 8:108978698-108978720 CTGACACAGTGTCTACTTGATGG - Intergenic
1046769596 8:118105161-118105183 CTGTGACATTGGCATATTAAAGG + Intronic
1051002529 9:12302433-12302455 CTAAGACAGTCACAACTTGAGGG + Intergenic
1055665446 9:78548368-78548390 CTGAGATAGTAGGAAATTCAAGG - Intergenic
1055666996 9:78562839-78562861 CTGAGACAGTAGCAACATGAGGG + Intergenic
1055968999 9:81893070-81893092 TTGAGGCAGTAGCAAATTGCTGG - Intergenic
1056761148 9:89415768-89415790 CTGAGACAGTGGCAATTCAGGGG + Intronic
1058740179 9:107935018-107935040 AAGAGACAGTGGCAAGTTAATGG + Intergenic
1059524818 9:114980835-114980857 CTAAGACAGTGGCCAAAGGAGGG + Intergenic
1059860557 9:118456133-118456155 TTGAGACAGTTGAGAATTGAAGG - Intergenic
1203604872 Un_KI270748v1:49930-49952 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1188208553 X:27391017-27391039 CTTGGACAGGGACAAATTGAAGG - Intergenic
1192240346 X:69323397-69323419 CTGAGGCAGAGGCAAGGTGAGGG + Intergenic
1194304712 X:92229345-92229367 ATGAGACCTTGGCAAAATGAGGG - Intronic
1195470834 X:105228046-105228068 CTGATACTGTAGCAAATTCAAGG - Intronic
1195766875 X:108305532-108305554 GCAGGACAGTGGCAAATTGATGG + Intronic
1196128970 X:112132073-112132095 CTGATACAGTGGGAAAATTATGG - Intergenic
1197257781 X:124282662-124282684 CAGAGACACTGGCACATTGAAGG - Intronic
1197662526 X:129189405-129189427 CTGAGACAATGGAAAGATGAGGG + Intergenic
1201270396 Y:12248466-12248488 CTAAGACAGTAGCACAGTGATGG + Intergenic
1201680465 Y:16639600-16639622 CTAAGACAGTAGCACAGTGATGG - Intergenic
1202387057 Y:24336326-24336348 GTGGGACAGTAGCAATTTGAAGG + Intergenic
1202483729 Y:25333802-25333824 GTGGGACAGTAGCAATTTGAAGG - Intergenic