ID: 931339068

View in Genome Browser
Species Human (GRCh38)
Location 2:61380904-61380926
Sequence TGCCATGCCGATTGGTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931339068_931339072 -1 Left 931339068 2:61380904-61380926 CCACAAGACCAATCGGCATGGCA 0: 1
1: 0
2: 0
3: 1
4: 50
Right 931339072 2:61380926-61380948 AATCACAGAATGTGGGAACAAGG 0: 1
1: 0
2: 3
3: 27
4: 316
931339068_931339071 -8 Left 931339068 2:61380904-61380926 CCACAAGACCAATCGGCATGGCA 0: 1
1: 0
2: 0
3: 1
4: 50
Right 931339071 2:61380919-61380941 GCATGGCAATCACAGAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 158
931339068_931339070 -9 Left 931339068 2:61380904-61380926 CCACAAGACCAATCGGCATGGCA 0: 1
1: 0
2: 0
3: 1
4: 50
Right 931339070 2:61380918-61380940 GGCATGGCAATCACAGAATGTGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931339068 Original CRISPR TGCCATGCCGATTGGTCTTG TGG (reversed) Intronic
901246441 1:7735611-7735633 CTTCATGCCGATTCGTCTTGGGG - Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
910483388 1:87683100-87683122 TGCCATGAAGGGTGGTCTTGGGG + Intergenic
1063606653 10:7528371-7528393 TGCCAGGCAGATGGCTCTTGGGG - Intergenic
1068147582 10:53090880-53090902 TGCCATGCCCACTGGTAATGGGG - Intergenic
1071510784 10:86261310-86261332 TGCCATGCCGGCAGGTCCTGGGG - Intronic
1073713384 10:106072009-106072031 TTCCATGCACATTGCTCTTGTGG - Intergenic
1077391153 11:2301193-2301215 TGCCATGCCTGCAGGTCTTGGGG + Intronic
1079545542 11:21628316-21628338 AGCCATGCCAGTGGGTCTTGGGG - Intergenic
1083378934 11:62248487-62248509 TGGGATGCCGACAGGTCTTGGGG - Intergenic
1084562139 11:69911106-69911128 TTCCTGGCCGAGTGGTCTTGAGG - Intergenic
1088448750 11:109960532-109960554 TGGCATGCCCTTTTGTCTTGGGG - Intergenic
1093838832 12:23870751-23870773 TGCCATTCCAAGTGGTTTTGAGG + Intronic
1098389976 12:69959350-69959372 TGCCATGCCCCCTTGTCTTGGGG + Intergenic
1104746226 12:131212025-131212047 AGGCATGCCGACTGCTCTTGGGG + Intergenic
1107945882 13:45417676-45417698 TGCCCTGCGGATTCGGCTTGCGG - Intronic
1121455961 14:94038989-94039011 TCCCATCCCCTTTGGTCTTGCGG - Exonic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143530350 17:7499401-7499423 TGACAGGCCGATTGCTCTGGGGG - Exonic
1155938577 18:31779849-31779871 TGCCAAGATGAGTGGTCTTGTGG - Intergenic
1160857716 19:1224789-1224811 AGCCATGCCGAGTGGTCTGGCGG - Intronic
925185123 2:1842063-1842085 TGCCATGCTATTGGGTCTTGTGG + Intronic
926572742 2:14547247-14547269 TGACATGCCCATTGTTATTGAGG + Intergenic
931339068 2:61380904-61380926 TGCCATGCCGATTGGTCTTGTGG - Intronic
937197112 2:120167885-120167907 TGCCATGTCTAATGGACTTGCGG + Exonic
938811013 2:134852761-134852783 TGCCATGCTGGTTGGGCTCGAGG - Intronic
939513785 2:143141005-143141027 TGCCATGCTGACTGGTCTCCAGG - Intronic
945391261 2:209267598-209267620 TGGCATGCCCTTTTGTCTTGGGG + Intergenic
946526268 2:220524161-220524183 TGCCTTGCAGAATGGTCTTAAGG + Intergenic
946939602 2:224757217-224757239 TCCCATGCTGTTTGTTCTTGTGG + Intergenic
948778200 2:240300889-240300911 AGCCATGGCTTTTGGTCTTGTGG + Intergenic
1168859869 20:1038300-1038322 TGTCATGCTCATTGGTTTTGTGG + Intergenic
1175162737 20:57021048-57021070 TGCCTTTCCGATTGTTTTTGAGG - Intergenic
954446068 3:50547550-50547572 TGTCATGCCTATGAGTCTTGTGG + Intergenic
955260912 3:57389689-57389711 TTCCTTGCCAATGGGTCTTGAGG - Intronic
968555052 4:1242629-1242651 TGCCATGAGGAGTGGTGTTGGGG - Intronic
974819944 4:67053384-67053406 AGCCATGCTGATTGGTATTAGGG + Intergenic
985431903 4:189889041-189889063 AGCCTTGCAGATTGGTTTTGAGG - Intergenic
993385617 5:87259816-87259838 TGCTATGATGATTGGTTTTGTGG + Intergenic
1003677166 6:8215940-8215962 TGCCATGCCGATTGCTGCAGAGG + Intergenic
1004286087 6:14322237-14322259 TGCCATCCAGATTGGGCCTGAGG - Intergenic
1006174414 6:32113404-32113426 TGGCATGCTGAGTGGCCTTGGGG + Intronic
1007588607 6:43007979-43008001 TGCGATGCAAAATGGTCTTGAGG - Exonic
1015055609 6:128899346-128899368 TGCCATAGCAATTGCTCTTGAGG - Intronic
1026841610 7:73672392-73672414 TACCATCCCGATTGGGCTTATGG - Intergenic
1035011031 7:155714963-155714985 TGCCATGCCCAGTGGCCTGGTGG - Intronic
1037612411 8:20487383-20487405 TTCCATGCCTGTTGGTCTTCTGG + Intergenic
1043657218 8:82683992-82684014 TGCAATGCTGACTGGTCATGGGG - Intergenic
1051107253 9:13594188-13594210 AGCCAAGCCGAATGGTCTTTAGG - Intergenic
1192229157 X:69252857-69252879 GGCCATGCCACTGGGTCTTGAGG - Intergenic
1199972675 X:152872441-152872463 TGCCATTCAGATGGGGCTTGAGG + Intergenic