ID: 931340808

View in Genome Browser
Species Human (GRCh38)
Location 2:61399041-61399063
Sequence TTTTTAGCTGTGCCCATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931340808_931340811 1 Left 931340808 2:61399041-61399063 CCTAACATGGGCACAGCTAAAAA 0: 1
1: 0
2: 2
3: 15
4: 181
Right 931340811 2:61399065-61399087 TCTCCTAACGGCCGGTGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 71
931340808_931340810 -7 Left 931340808 2:61399041-61399063 CCTAACATGGGCACAGCTAAAAA 0: 1
1: 0
2: 2
3: 15
4: 181
Right 931340810 2:61399057-61399079 CTAAAAAATCTCCTAACGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931340808 Original CRISPR TTTTTAGCTGTGCCCATGTT AGG (reversed) Intronic
900686223 1:3949511-3949533 TCCTTAGCTGTGACCATCTTAGG - Intergenic
905781849 1:40718376-40718398 TCTATAGCTGTGTCCATCTTCGG + Intronic
906539649 1:46575497-46575519 GGTCTAGCGGTGCCCATGTTAGG - Intronic
907878590 1:58520533-58520555 TTTTTATCTTTGCCCTTTTTTGG - Intronic
909610434 1:77546238-77546260 ATTTTGCCTTTGCCCATGTTAGG + Intronic
911457517 1:98145064-98145086 ATTTTGGCTGTCCCCATGCTTGG - Intergenic
912404189 1:109423016-109423038 TTTATAGCTGAGACCATGATTGG - Intronic
914978134 1:152385713-152385735 TTTTTTGTTGTGCCCTTGTCTGG + Intergenic
917049905 1:170910071-170910093 TTTTTTGCTGTGTCCACATTTGG - Intergenic
917151595 1:171951452-171951474 TCTTTAACTGTGCTTATGTTTGG + Intronic
918560540 1:185861278-185861300 TTCTTAGCTGTCCTCATGTTTGG + Intronic
920089816 1:203444403-203444425 TTTGTAGGTGTGACCATCTTTGG + Intergenic
920583891 1:207138663-207138685 GTTTGAGCGGGGCCCATGTTAGG - Intronic
921161726 1:212477496-212477518 TTTTTAACAGTGCCCTTGGTTGG - Intergenic
924228924 1:241947088-241947110 TTCTTAGCTGTGCACAATTTGGG - Intergenic
1063263991 10:4425182-4425204 TTTTTCTCAGTGACCATGTTAGG + Intergenic
1064268000 10:13840474-13840496 TTTTTAACTGTCACCATATTAGG - Intronic
1065518534 10:26549288-26549310 TTTTTTGTTGTGTCCATGTTTGG + Intronic
1066092789 10:32042213-32042235 CACTTAGTTGTGCCCATGTTGGG - Intronic
1069059531 10:63880889-63880911 TATTTAGGTGTTCCAATGTTTGG + Intergenic
1069269707 10:66510853-66510875 TTTTTTGTTGTGCCCTTGTCTGG + Intronic
1070127123 10:73631400-73631422 TTTTTAGCTTTGCCAACATTTGG + Intergenic
1072132444 10:92508614-92508636 TTGTTAGATGTGACCATTTTGGG - Intronic
1084734473 11:71095408-71095430 TGTTTAGCAGTGGCCATGGTGGG - Intronic
1089088686 11:115847240-115847262 TTTTCAGTTGGGCCCCTGTTCGG - Intergenic
1090429933 11:126637169-126637191 TTTTTAGCTGGACCTATTTTTGG + Intronic
1090626575 11:128613793-128613815 GTCTCAGCTGTGCCCATGGTGGG + Intergenic
1097366982 12:58726858-58726880 CATTTAGCTGTGCCCCTCTTTGG - Intronic
1097525881 12:60735271-60735293 TTTTTTGTTGTGTCCTTGTTTGG + Intergenic
1098396276 12:70020982-70021004 TTTTTTGTTGTGCCTTTGTTTGG - Intergenic
1099430686 12:82581271-82581293 TTTTTAGGTGCTCTCATGTTGGG - Intergenic
1100093843 12:91007215-91007237 TTCTTAGTAGTGCCCATGCTTGG + Intergenic
1102312857 12:111860581-111860603 TTCATAGCTGGCCCCATGTTGGG + Intronic
1107351006 13:39514676-39514698 TTTGGAGCTGTGCTCAGGTTGGG - Intronic
1108769159 13:53676725-53676747 TTTTTTGTTGTGTCCTTGTTTGG + Intergenic
1109145843 13:58778952-58778974 TTTTTTGCTGTGCACTTCTTTGG - Intergenic
1110304846 13:73973794-73973816 TTTTAAGCTGTGTAAATGTTAGG - Intronic
1110304935 13:73975478-73975500 TCTTTAGCTGTGCCTAAGCTTGG - Intronic
1110307358 13:74004920-74004942 TTTTTGTCTGTGCACAGGTTTGG - Intronic
1115661591 14:35500100-35500122 CTTTTTGCTGTGCCCTTGTCCGG - Intergenic
1124195284 15:27620092-27620114 ATTGCAGCTGTGCCCATGTTTGG - Intergenic
1125775325 15:42207788-42207810 TTTTTAGTTGTGCTCAGCTTTGG - Intronic
1126286778 15:47021911-47021933 TATTTAGATGTTCCAATGTTAGG - Intergenic
1126851919 15:52802289-52802311 TTTCCAGCTGTGGCCAGGTTGGG - Intergenic
1129859017 15:78845842-78845864 TTTTTATCTGTGTCTATTTTAGG + Intronic
1129905184 15:79182349-79182371 TCTTTAGCTGTACCCAGCTTGGG + Intergenic
1133376069 16:5288333-5288355 TTATGAGCTGTGTCTATGTTGGG + Intergenic
1133951845 16:10401564-10401586 TTTTTTGCTGTGTCCTTGCTTGG + Intronic
1135832881 16:25793422-25793444 TTTTTAGTTGTGTCAATTTTTGG + Intronic
1137075344 16:35954854-35954876 TTTTTGGTTGTGCCCAGCTTTGG + Intergenic
1142054411 16:87983674-87983696 TTTTATGCTGTGTCGATGTTAGG + Intronic
1146040493 17:29449059-29449081 TTTCTAGCTGGGTCCATGATCGG - Intronic
1146124251 17:30219371-30219393 TTTTGTGTTGTGCCCATGCTTGG - Intronic
1151356400 17:73561139-73561161 TTTCTAGCTGTGCCCGAGATGGG + Intronic
1155977685 18:32148822-32148844 TTTTTTGCTGTGTCCTTGTCTGG + Intronic
1157722177 18:49933598-49933620 TTTTTAGCTGTCACAATGATGGG + Intronic
1158851775 18:61501932-61501954 GTTATAGCTGTGCCCATGGGGGG + Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
929312023 2:40436376-40436398 TTTTGAACTCTGCTCATGTTAGG - Intronic
930087168 2:47505895-47505917 TTGTTTCCAGTGCCCATGTTAGG - Intronic
930161328 2:48159713-48159735 TCTTTTGCTGTGTCCATGTCTGG - Intergenic
930884294 2:56306896-56306918 TTTCTAGCTGTTACCATGTTAGG + Intronic
931036947 2:58254410-58254432 ATTTTAACTGTGTCCATTTTTGG - Intergenic
931340808 2:61399041-61399063 TTTTTAGCTGTGCCCATGTTAGG - Intronic
932813995 2:74847043-74847065 TTTTTAGCTGTGGTCATCTAGGG + Intronic
933153474 2:78943484-78943506 TCTTTTGCTTTGCCCTTGTTTGG - Intergenic
935964337 2:108458389-108458411 TTTTTTGCTGTGTCCTTGTCTGG + Intronic
940154806 2:150644318-150644340 GGTTGAGCTGTGTCCATGTTTGG - Intergenic
940877435 2:158912181-158912203 TTTTTTGCTATGCTCATATTTGG + Intergenic
941467793 2:165850695-165850717 TTTTTTGTTGTGCCCTTGTCTGG + Intergenic
941799114 2:169635340-169635362 TTTTTAGATTTGGCCATGTTTGG + Intronic
946083017 2:217142313-217142335 TTTCCAGCTGTGTGCATGTTTGG + Intergenic
948099753 2:235364503-235364525 TTTTTAGCAGGGGCCAGGTTGGG + Intergenic
949053347 2:241909803-241909825 TCTTTAGCTGTGAACATCTTAGG + Intergenic
1168952450 20:1811651-1811673 TTGTTACCTGAGCCCATCTTTGG + Intergenic
1169759333 20:9074303-9074325 TCTTTGGGTGTGCCCAGGTTTGG + Intronic
1171099878 20:22373068-22373090 TGTTTAACAGTGCCCAGGTTAGG + Intergenic
1172237181 20:33385609-33385631 TTTCTTGCTGTGAACATGTTTGG - Intronic
1174235264 20:49085111-49085133 TTTTTACATGTGCTCATGTTAGG - Intronic
1174458768 20:50668184-50668206 TTTTTCGCTGTGCACAGGTGGGG + Intronic
1175127796 20:56765285-56765307 CTTCTGGCTGTGCCCTTGTTTGG - Intergenic
1177430150 21:20982373-20982395 TTTATAGCTGTTCCCTTCTTTGG + Intergenic
1177660720 21:24079869-24079891 TTTTTAGCTATGCCTTTGTCTGG - Intergenic
1178787421 21:35666669-35666691 TTTTTATCTGTGAGCCTGTTGGG - Intronic
1178949736 21:36976223-36976245 TTTTTAGATGTGTCCAAGTTGGG - Intronic
1181846231 22:25711514-25711536 TTTTTAGATCTCCCCGTGTTAGG + Intronic
1182950918 22:34375000-34375022 TCTTAAGTTGTGCCCTTGTTAGG + Intergenic
1184524092 22:45011351-45011373 TTTTTAGTCGAGACCATGTTGGG - Intergenic
1185332156 22:50256686-50256708 CTCTTGGCTGTGCCCATGCTTGG - Intronic
949512415 3:4778291-4778313 TTTTTAACTGTTCCCATGTCAGG + Intronic
950617780 3:14176009-14176031 GCTTTAGCTTTACCCATGTTAGG - Intronic
950981371 3:17309790-17309812 TTTTTTGCTGTGCCCATCTCTGG - Intronic
951209834 3:19963274-19963296 TTTTTAACTGTTCCATTGTTGGG + Intronic
953266339 3:41392689-41392711 TTTTTAGATGTGCTCCTGGTGGG + Intronic
953437049 3:42885899-42885921 TTCTTCGCTGTGGGCATGTTAGG + Intronic
956577749 3:70773396-70773418 TTTCTAGATGTGTCCTTGTTCGG + Intergenic
957768059 3:84651360-84651382 TCTTTAGCTGCTCCAATGTTAGG - Intergenic
958129415 3:89398827-89398849 TTTTTAGAAATGCCCATGTTGGG + Intronic
958743719 3:98108480-98108502 TTTTTAGGTGTGCCAATGTTGGG + Intergenic
959752255 3:109852244-109852266 TATTTAGGTGTTCCAATGTTGGG - Intergenic
959910840 3:111761977-111761999 CTTTTAGCAGTGCCCCTTTTAGG - Intronic
960236884 3:115293522-115293544 TTCTTAGCTCTGCCCTAGTTAGG + Intergenic
961623528 3:128243545-128243567 TATTAAGCTGTGCCCAAGCTGGG + Intronic
964404222 3:156331694-156331716 ATGTTAGCTATGTCCATGTTTGG + Intronic
964456391 3:156871896-156871918 TTTTTAGTTGTGTCCTTGTCTGG + Intronic
964638362 3:158882027-158882049 TTGTTTGCTGTGTCCATGTCTGG + Intergenic
965763200 3:172102912-172102934 TTTTCAGTTATTCCCATGTTTGG + Intronic
966305267 3:178525822-178525844 TTTTTAGCTGTTCAGTTGTTTGG + Intronic
967321071 3:188196049-188196071 TTTTTAGCAGTGCTCTTATTTGG + Intronic
969925047 4:10577451-10577473 TGTTTAGCTGGGCACATGGTCGG + Intronic
971515292 4:27478383-27478405 ATTTTAACTTTGCCCATTTTGGG - Intergenic
971894492 4:32574510-32574532 TTTTTCACTGTGTCCTTGTTTGG - Intergenic
971961952 4:33500088-33500110 TTATTAGCTGTGTGCATATTGGG + Intergenic
972713148 4:41618960-41618982 TTTTTAGTTTTGCCCTTGTCAGG + Intronic
974038275 4:56836231-56836253 TTTTTGGATGTGCACATCTTTGG - Intergenic
975704353 4:77097295-77097317 TTTTTATCTATTCCAATGTTGGG + Intergenic
975949484 4:79751338-79751360 TTTTTTGCAGTGTCCTTGTTTGG - Intergenic
976435413 4:85012405-85012427 TTTTTAGCTGCCCCCATTTGTGG + Intergenic
976508125 4:85873185-85873207 TTGCTAGCTGTGTTCATGTTGGG + Intronic
977043153 4:92039158-92039180 TTTGAACCTGGGCCCATGTTTGG - Intergenic
979560562 4:122096910-122096932 TTTTCAGCTTGGCCCATCTTTGG - Intergenic
980166515 4:129234518-129234540 TTTTTTCCTGTGCCCATGTTTGG - Intergenic
980459365 4:133086487-133086509 TCTCTTGCTGTGCCCATTTTTGG - Intergenic
980797956 4:137710498-137710520 TTTTTTGTTGTGCCCTTGTTTGG + Intergenic
981022928 4:140047724-140047746 TCTTCTGCTGTGCCCATTTTGGG - Intronic
983281291 4:165683929-165683951 ATCTGAGCTGTGCCAATGTTTGG - Intergenic
984063134 4:175016991-175017013 TTTTTTGATGAGCCCATATTGGG + Intergenic
984214650 4:176895420-176895442 TTTACAGCTGGGGCCATGTTGGG - Intergenic
988626485 5:32881100-32881122 TTTTTTGTTGTGTCCTTGTTTGG + Intergenic
989504487 5:42211279-42211301 TTTTTTGATGTGTCCTTGTTTGG + Intergenic
990010082 5:50987108-50987130 TATTTATCTGTGCCCATGCAAGG + Intergenic
990839431 5:60060368-60060390 TTTCTATCTGTTCCCATGTGTGG + Intronic
991340951 5:65608257-65608279 TTGCCAGCTGGGCCCATGTTAGG - Intronic
992026876 5:72679089-72679111 TTTTTGGTTGTGCCCTTGTCTGG + Intergenic
993140142 5:84022091-84022113 TTTTTTATTGTGCCCTTGTTTGG - Intronic
995074246 5:107962847-107962869 TTTGTAGATGTGCCCAAATTTGG + Intronic
995114544 5:108464892-108464914 TTTTTAGCTGGGCATATGTTTGG + Intergenic
996584939 5:125076290-125076312 TTTTTTACAGTGCCCTTGTTTGG - Intergenic
996600718 5:125259947-125259969 TGCTTAAATGTGCCCATGTTGGG - Intergenic
998681752 5:144475315-144475337 GCTTTGGCTGTGCCCATGCTAGG + Exonic
999549122 5:152664931-152664953 TATTTAGGTGTTCCAATGTTAGG - Intergenic
1000237324 5:159374170-159374192 TTTTTTGCTGTGTCCTTGTCTGG + Intergenic
1001262052 5:170238898-170238920 TTTTGATCTGTTCCCTTGTTTGG - Intronic
1001790259 5:174450230-174450252 TTTTTTGTTGTGCCCTTGCTTGG - Intergenic
1003268186 6:4584910-4584932 TATTTAGCTGATCCCATTTTTGG - Intergenic
1007171101 6:39864316-39864338 TTCTCAGCTCTGCCCATGTCGGG - Intronic
1008009356 6:46447297-46447319 TTTTTAGATGTTCCAATGTTGGG - Intronic
1009024826 6:57985991-57986013 GTTTCAGCTGTGCCCTTGGTCGG - Intergenic
1009200406 6:60737463-60737485 GTTTCAGCCGTGCCCTTGTTCGG - Intergenic
1009302700 6:62046226-62046248 TTTTTCCCTGTGAGCATGTTAGG - Intronic
1010077166 6:71812470-71812492 TATTTAGATGTCCCAATGTTGGG - Intergenic
1010462323 6:76127605-76127627 TTTTTAGCTATGAACATTTTTGG + Intergenic
1011483494 6:87818534-87818556 TTTTCAGATGTGTCCCTGTTTGG + Intergenic
1013702653 6:112792577-112792599 TATTTAGATGTTCCAATGTTAGG + Intergenic
1020919939 7:14250798-14250820 TATTTAGGTGTGCCAATATTTGG + Intronic
1021198685 7:17701345-17701367 TATTTAGGTGTACCAATGTTAGG - Intergenic
1022617682 7:31948842-31948864 CTTTTTGCTGTGCCCCAGTTTGG - Intronic
1022766161 7:33414796-33414818 TTTTTAGATGTGGAGATGTTGGG + Intronic
1023339840 7:39208502-39208524 TTTTTAGCTGGTCAAATGTTAGG + Intronic
1023609526 7:41958887-41958909 TTTTTAGCTGTCACCACGTGGGG + Intergenic
1023724967 7:43133991-43134013 TATATAGCTGTGTCCATCTTCGG + Intronic
1026013802 7:66656500-66656522 TTTTTAGCTGGGTCCCTGTGTGG + Intronic
1026025860 7:66742988-66743010 TTTTTAGCTGGGTCCTTGTGTGG + Intronic
1031587390 7:123548722-123548744 TTTTGATGTGTGGCCATGTTTGG - Intronic
1031780089 7:125950585-125950607 TTTTTTTCTGTGTCCATTTTTGG - Intergenic
1033166699 7:139045066-139045088 GTTACAGCTGTGCCCAAGTTAGG + Exonic
1034749646 7:153556790-153556812 TTCATAGATGTGCCCATTTTAGG - Intergenic
1039033635 8:33335593-33335615 TTTTCAACTATGCCCAGGTTTGG - Intergenic
1039483397 8:37892622-37892644 CTTTTAGTAGAGCCCATGTTGGG + Intronic
1040410618 8:47150930-47150952 TTTTTCTCTGTGTACATGTTTGG - Intergenic
1045253362 8:100499595-100499617 TCTTAAGCTGGCCCCATGTTGGG + Intergenic
1045907905 8:107370522-107370544 TTTTTAGTAGAGACCATGTTGGG - Intronic
1047752096 8:127889612-127889634 GTTTTAGCTGTGGCCATTCTGGG + Intergenic
1050287947 9:4123064-4123086 TTTTTGGGTGTGCTCATCTTGGG - Intronic
1050630389 9:7552359-7552381 TTTTTGTCTGTGCCCATTTTTGG - Intergenic
1051915873 9:22207105-22207127 TATTTAGCTTTGTCCAGGTTGGG + Intergenic
1051919608 9:22249976-22249998 TTTTTAGCTGTGTCCTTGCCAGG + Intergenic
1052050761 9:23846723-23846745 TTTTTAACTGTACCCACATTGGG - Intergenic
1052126291 9:24779244-24779266 ATATTAGCTGTGCCTGTGTTAGG - Intergenic
1054802819 9:69368610-69368632 TTTTTTGTTGTGTCCTTGTTTGG + Intronic
1056802019 9:89698929-89698951 TTTTTAACTGAGCCCATTGTTGG + Intergenic
1057137981 9:92707657-92707679 TGTTTAGCTTTTCCCTTGTTAGG + Intergenic
1057318559 9:93990116-93990138 TTTTTTGTTGTGTCCTTGTTTGG - Intergenic
1060790446 9:126482298-126482320 TCTTTAGCTGTGCCCAAGCTGGG - Intronic
1186603320 X:11062043-11062065 TCTTTAGCTAAACCCATGTTAGG - Intergenic
1190177219 X:48160598-48160620 TTTTTAGTTGTTCACATCTTGGG + Intergenic
1192615559 X:72617916-72617938 TTTTTTGTTGTGTCCTTGTTTGG - Intronic
1192892542 X:75406860-75406882 TTTTTCACTGTGTCCTTGTTTGG - Intronic
1192989930 X:76439894-76439916 TTTTTTGTTGTGCTCCTGTTTGG + Intergenic
1193895270 X:87107409-87107431 TTTTTAGCTATTGACATGTTAGG - Intergenic
1194202518 X:90971925-90971947 TTTTTTTCTGTGGCCATTTTTGG + Intergenic
1195970737 X:110470464-110470486 GTTTAAATTGTGCCCATGTTTGG + Intergenic
1196548237 X:116990931-116990953 TTGTTAGCATTGCCCAAGTTTGG + Intergenic
1197260914 X:124316820-124316842 TTTTTTGTTGTGCCCTTGTCTGG - Intronic
1199033887 X:143030104-143030126 TTTTAAGATGGGCCCATGTGAGG + Intronic
1200285897 X:154822014-154822036 TATTTAGCTGCTCCAATGTTGGG - Intergenic
1200548354 Y:4547380-4547402 TTTTTTTCTGTGGCCATTTTTGG + Intergenic
1201337656 Y:12897630-12897652 TTGTTTGCTGTGCCCAAGATAGG - Intergenic
1201970718 Y:19791448-19791470 TATTTAGCTGTTCCAATGCTTGG - Intergenic