ID: 931341740

View in Genome Browser
Species Human (GRCh38)
Location 2:61408543-61408565
Sequence CTGTTAATCAGAAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931341740_931341743 8 Left 931341740 2:61408543-61408565 CCTACAATTCTTCTGATTAACAG 0: 1
1: 0
2: 2
3: 11
4: 168
Right 931341743 2:61408574-61408596 TTTGATGTTTAGGAAAAATCAGG 0: 1
1: 0
2: 3
3: 19
4: 388
931341740_931341741 -2 Left 931341740 2:61408543-61408565 CCTACAATTCTTCTGATTAACAG 0: 1
1: 0
2: 2
3: 11
4: 168
Right 931341741 2:61408564-61408586 AGCTTTTTCCTTTGATGTTTAGG 0: 1
1: 0
2: 2
3: 45
4: 441
931341740_931341744 22 Left 931341740 2:61408543-61408565 CCTACAATTCTTCTGATTAACAG 0: 1
1: 0
2: 2
3: 11
4: 168
Right 931341744 2:61408588-61408610 AAAATCAGGTTTAAAGTAAGAGG 0: 1
1: 1
2: 1
3: 36
4: 372
931341740_931341745 27 Left 931341740 2:61408543-61408565 CCTACAATTCTTCTGATTAACAG 0: 1
1: 0
2: 2
3: 11
4: 168
Right 931341745 2:61408593-61408615 CAGGTTTAAAGTAAGAGGTCAGG 0: 1
1: 1
2: 0
3: 7
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931341740 Original CRISPR CTGTTAATCAGAAGAATTGT AGG (reversed) Intronic
901462875 1:9401988-9402010 CTGTGAATCAGAGGAACTGCCGG - Intergenic
906339881 1:44970065-44970087 CAGTAAATCAGTAAAATTGTGGG + Intronic
907454095 1:54564309-54564331 CTGTTATTCAGAAGCCTGGTAGG + Intronic
908465428 1:64388915-64388937 CTGCTAAACAGATGAATGGTGGG - Intergenic
908854779 1:68413642-68413664 CTGTTATTCTGTTGAATTGTTGG + Intergenic
909780088 1:79533929-79533951 CATTTAATCAAAAGAAATGTAGG + Intergenic
910868350 1:91808431-91808453 AAGTAAATCAGAAGAACTGTTGG - Intronic
912971110 1:114284353-114284375 CTTTTTTTCAGAACAATTGTGGG + Intergenic
913088802 1:115462126-115462148 CTGTCATCCAGCAGAATTGTAGG - Intergenic
913733971 1:121753124-121753146 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913734094 1:121755498-121755520 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913846758 1:123526566-123526588 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913855033 1:123675441-123675463 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913872986 1:123997635-123997657 CTGCTAGACAGAAGAATTCTCGG + Intergenic
913906219 1:124592702-124592724 CTGCTAGACAGAAGAATTCTCGG + Intergenic
915559465 1:156678100-156678122 CAGTTATACAGAAGACTTGTAGG - Intergenic
916534317 1:165689079-165689101 CTGTGAATGAGCAGCATTGTAGG - Intronic
916646460 1:166790703-166790725 TTTTTTATCAGAAGAATTGTTGG + Intergenic
918914082 1:190612471-190612493 CACTTTATCAGAAGAAATGTTGG - Intergenic
919470540 1:197973648-197973670 CTGTTAAAGTGAAGAAATGTAGG + Intergenic
919985277 1:202669779-202669801 CTATTAAAGATAAGAATTGTGGG - Intronic
920023513 1:202974711-202974733 GTGTGAAGCAGAAGAATTGCAGG - Intergenic
924090775 1:240498697-240498719 TTGCTAATCAGAAAAATGGTTGG + Intronic
1066062862 10:31739552-31739574 CTGTACATCAGAAGAGTTGCAGG + Intergenic
1066249950 10:33623623-33623645 CTGTTAATCTGAAGATCTGAAGG + Intergenic
1066825830 10:39574567-39574589 CTGCTATACAGAAGAATTCTCGG + Intergenic
1066981541 10:42420974-42420996 CTGTCATTCATAAGAATTCTTGG - Intergenic
1068761854 10:60720978-60721000 CTGTTAATCATAAAAATGCTTGG - Intronic
1069351964 10:67538088-67538110 CTGTTGACTAGAAGATTTGTAGG - Intronic
1070072922 10:73107162-73107184 CAGCTAATCAGTAGAAGTGTTGG - Intergenic
1076670155 10:132116178-132116200 TTGTTATTCATGAGAATTGTTGG - Intronic
1084436091 11:69141176-69141198 CTGTAAATCATAAGAATAGAAGG + Intergenic
1085005952 11:73090523-73090545 CTGTAATTAAGAAGTATTGTAGG - Intronic
1086186420 11:84022320-84022342 CTGTTCATAAAAAGATTTGTAGG + Intronic
1087276557 11:96166773-96166795 TTTTTATTCAGAAGAATTTTAGG - Intronic
1087738383 11:101859923-101859945 CTGTTAATAGGAAGAGTTGAGGG + Intronic
1093916962 12:24814554-24814576 ATCTTAGTCAAAAGAATTGTTGG - Intronic
1094038310 12:26094732-26094754 CTGAGAATCAGAAGTACTGTTGG + Intergenic
1094972216 12:36269068-36269090 ATGTTACACAGAAGAATTCTCGG + Intergenic
1094976659 12:36340397-36340419 ATGTTACACAGAAGAATTCTCGG + Intergenic
1096853866 12:54463796-54463818 GTGTTAATCTGAAAAATTATTGG - Intronic
1097112277 12:56669581-56669603 CTGTTAAACACAAGAATCATAGG - Intronic
1097775721 12:63642305-63642327 CAGTTCCTCAAAAGAATTGTAGG - Intronic
1098475188 12:70892922-70892944 CAATTAATCAGAAGAAGAGTGGG - Exonic
1101822827 12:108197096-108197118 GTGTTAATCTTATGAATTGTAGG - Intronic
1107033298 13:35875558-35875580 CTTCTTATCAGAAGAAATGTAGG + Intronic
1107151755 13:37119704-37119726 CTGTTAATCAGAAGAGATAAAGG - Intergenic
1107625867 13:42283502-42283524 CTGCTATTCAGGAAAATTGTGGG + Intronic
1107721347 13:43251804-43251826 CTGGTATTCAGAAAAAATGTTGG - Intronic
1108424461 13:50285057-50285079 CTATTTATCAGAACTATTGTGGG - Intronic
1108901603 13:55416107-55416129 CTGTTACTCTGAAGAATTTAAGG + Intergenic
1108932085 13:55837810-55837832 CTGTTAATGAGAGGAATAGGGGG - Intergenic
1109978629 13:69874930-69874952 CTGTTTTTCAGAAGAAATTTAGG + Intronic
1113176220 13:107566986-107567008 CTTTTAATCAGAAAAAATATAGG - Intronic
1113722083 13:112566040-112566062 TTGTTAATCAAATGAATTGGTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115828352 14:37303828-37303850 CAGTTAATCTGAAGAATTTTTGG + Intronic
1117539796 14:56735726-56735748 CTGATACACAGAAGAGTTGTGGG + Intergenic
1122010115 14:98739397-98739419 CTGTTAATCACAAAAGATGTTGG - Intergenic
1202839840 14_GL000009v2_random:111474-111496 CTCTTGATGAGAAGAATAGTAGG - Intergenic
1123576971 15:21680438-21680460 CTGTTGATCAGAAGCTTTGCTGG - Intergenic
1123613593 15:22122906-22122928 CTGTTGATCAGAAGCTTTGCTGG - Intergenic
1123804431 15:23856667-23856689 CTGTAAATCAGAATCTTTGTAGG + Intergenic
1125431707 15:39602016-39602038 CTTTTAATGGGATGAATTGTAGG + Intronic
1129026739 15:72582904-72582926 CTGTTTATCTGCAGAACTGTGGG + Intronic
1131816842 15:96230689-96230711 TTATTACTCAGAAGAATTGGTGG + Intergenic
1131884025 15:96890251-96890273 CTGCCATCCAGAAGAATTGTAGG + Intergenic
1202985839 15_KI270727v1_random:414683-414705 CTGTTGATCAGAAGCTTTGCTGG - Intergenic
1133309218 16:4832192-4832214 CTTGTCATCAGAAGAATTGTGGG + Exonic
1135712769 16:24731472-24731494 CTGTTACTCAAAATAATTATGGG + Intronic
1145058268 17:19716977-19716999 CCGTTTTTCAGAAGAATTGGTGG + Intronic
1148616287 17:49002942-49002964 CTGTCCCTTAGAAGAATTGTAGG + Intronic
1150751251 17:67864732-67864754 CTGTGGATCAGAAGTATTATGGG + Intronic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1159487296 18:69078867-69078889 ATGTTTTTCAGAAGAATTTTAGG - Intergenic
1164042153 19:21502963-21502985 CTGTGAAACAGCAGAACTGTGGG - Intronic
1165871226 19:38975140-38975162 CTGTGAATCAGAAGCCTTGGAGG - Intronic
1167986564 19:53323624-53323646 CAGTTAATCAGAAGTATGGGTGG - Intergenic
927364813 2:22282197-22282219 ATAATAATCAGAAGAATTGCAGG + Intergenic
928700714 2:33895992-33896014 ATGTTACTCAGAAGAAAAGTAGG + Intergenic
929229102 2:39540950-39540972 TTGTAAATCAGTAGAATTTTTGG - Intergenic
929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG + Intronic
929911002 2:46089484-46089506 CTGTGTTTTAGAAGAATTGTGGG - Intronic
931341740 2:61408543-61408565 CTGTTAATCAGAAGAATTGTAGG - Intronic
935245446 2:101215288-101215310 CTGTTAATCACAAGAAATGTAGG - Intronic
937130613 2:119509628-119509650 CAGTTAAAAAAAAGAATTGTTGG - Intronic
937564451 2:123266978-123267000 GTTTTAAGCAGAAGAATTGTGGG - Intergenic
940568507 2:155400296-155400318 CTGTTAAACAGAATGATTTTAGG + Intergenic
941503372 2:166309262-166309284 ATTTTAATAAAAAGAATTGTTGG + Intronic
942588344 2:177511420-177511442 GTTTTAATCAGAAGACTTGCTGG - Intronic
942708743 2:178807556-178807578 CTGTCAATCAGAAGAACAGGTGG - Intronic
942821457 2:180120697-180120719 CTGGTCATCAGAAGTATGGTAGG - Intergenic
943416109 2:187606582-187606604 GTAATAATCAGAAGAATTGATGG + Intergenic
945417462 2:209591704-209591726 ATGGTAATCAGAAGAACTCTTGG - Intronic
1172542290 20:35728085-35728107 CTCTTAAAAATAAGAATTGTAGG - Intronic
1174210465 20:48874253-48874275 CTGTAAATCAAAAGAATTTTTGG - Intergenic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1174803684 20:53587487-53587509 CTGTTAATCAGAAGAAACAGAGG - Intronic
1175018613 20:55819542-55819564 CTGATAATCTGAAGAAGAGTGGG - Intergenic
1177381783 21:20353788-20353810 TTGTTTATCAGAGGAATTGAAGG - Intergenic
1178700600 21:34830426-34830448 TTGATAATAAGAAGAATTTTGGG - Intronic
1179213860 21:39349440-39349462 CAGGTATCCAGAAGAATTGTGGG - Intronic
1181973921 22:26714701-26714723 CGGTTAATGAGGAGAATTGGTGG - Intergenic
950959783 3:17093554-17093576 CTGGAATTCAGAAGAATGGTTGG - Intergenic
951493910 3:23303681-23303703 CTTGAAATCTGAAGAATTGTTGG + Intronic
951958825 3:28291654-28291676 CTGTTTCTCTGAAAAATTGTGGG + Intronic
952125544 3:30295871-30295893 CAGCTACTCAGAAGTATTGTTGG - Intergenic
954084627 3:48234346-48234368 ATGTTAACAAGATGAATTGTAGG - Intergenic
959202727 3:103269557-103269579 CCTTTAAACAGAAGACTTGTGGG + Intergenic
959412102 3:106037022-106037044 CTTTTAATCAGAGGATTTTTTGG + Intergenic
963958663 3:151284111-151284133 CTGTTTATCAGAACAACTGTGGG - Intronic
964469432 3:157036761-157036783 ATGTTGAGCAGAAGAATGGTGGG + Intronic
965100041 3:164284729-164284751 CTGAGAATCAGAAGAACTGAGGG - Intergenic
965103706 3:164334274-164334296 TTATTAATCAGACGAATTCTTGG + Intergenic
965676683 3:171205077-171205099 CTGTTAATAAGAACAATGGTAGG - Intronic
970135242 4:12914840-12914862 CTGAGAATCAGAAGAACTGAGGG + Intergenic
970404366 4:15748215-15748237 TTGTTAACCAAAAGAATTGTAGG - Intergenic
970459656 4:16260583-16260605 CTGTTAGTGAGAAGAAATGGAGG + Intergenic
970733569 4:19138409-19138431 CTGTCAATGAGTACAATTGTAGG + Intergenic
970892639 4:21065428-21065450 CTGTAAATCAAACCAATTGTAGG - Intronic
971541396 4:27821367-27821389 CTTTTAATCTGGAGAATTCTAGG - Intergenic
980351925 4:131694573-131694595 CTATCAATCAGAAAAAGTGTTGG - Intergenic
981129716 4:141144680-141144702 TTCTTAATCAGAGGAAATGTAGG + Intronic
981832816 4:149021687-149021709 CCATTTCTCAGAAGAATTGTTGG + Intergenic
982739279 4:159040848-159040870 ATGTTACTCAGACGAGTTGTTGG - Intergenic
986915563 5:12615549-12615571 CTGTTTGTCAGCAGAATTGGGGG - Intergenic
987682154 5:21150688-21150710 CTGTTAATCAGAAAATATCTTGG + Intergenic
988350181 5:30094356-30094378 TTGTTAATCAAAAGCATTGTGGG - Intergenic
988708654 5:33751817-33751839 CTGTGAACCTAAAGAATTGTAGG - Intronic
989352809 5:40506239-40506261 CTGAGAACCAGAAGAATTGATGG - Intergenic
994083533 5:95733253-95733275 CTGTTCATAAGAAGTATTGATGG + Intronic
995163045 5:109004122-109004144 CTGTCATTCAGAAAAGTTGTAGG - Intronic
1000878536 5:166669707-166669729 CTGATACTCAGAAGAGTTATTGG + Intergenic
1001659407 5:173379541-173379563 CTGTTGATGGGCAGAATTGTCGG + Intergenic
1008057752 6:46962815-46962837 CTGCTAACTAGAAGAATGGTGGG - Intergenic
1010171890 6:72984852-72984874 CTGTTATTAAAAAAAATTGTTGG - Intronic
1010832906 6:80552900-80552922 CTGCTAATCAGATGTAATGTTGG + Intergenic
1011749087 6:90437391-90437413 GAGTTAATCATAAGCATTGTTGG - Intergenic
1012377271 6:98577612-98577634 CTGGTAATCAGTGGAATTGGAGG - Intergenic
1015001109 6:128216946-128216968 CTGTTATTCAAAAGCATTCTAGG + Intronic
1016891338 6:149010404-149010426 GTGTTAACCAGAAGAAGTGCAGG + Intronic
1020378505 7:7515151-7515173 CTGATAATAACAAGAACTGTGGG + Intronic
1022686664 7:32603525-32603547 TTGTCAATCAGATGAATTCTTGG + Intergenic
1023114242 7:36845825-36845847 CTGGTATGCAGAAGAATTGATGG + Intergenic
1024068380 7:45764603-45764625 CTGTTAATGAAAAATATTGTTGG - Intergenic
1024113527 7:46171206-46171228 CTGTAAAACAGCAGAATTATAGG + Intergenic
1024631300 7:51249677-51249699 CTGATCAACAGAAGAATTGTAGG - Intronic
1027474443 7:78611780-78611802 CTTTCAAGCATAAGAATTGTTGG - Intronic
1030924584 7:115436232-115436254 CTGTTAGTCAGACTAATGGTTGG + Intergenic
1032243419 7:130185367-130185389 CTGTTTATCTTAACAATTGTAGG - Exonic
1033380070 7:140807650-140807672 CTGTTAATCTAAACAAATGTTGG + Intronic
1034307304 7:150054633-150054655 CAGTTAACCAGCAGAAATGTGGG + Intergenic
1034799543 7:154046048-154046070 CAGTTAACCAGCAGAAATGTGGG - Intronic
1035875206 8:3181310-3181332 CTGGTAATCAGACAAACTGTAGG - Intronic
1035876161 8:3191698-3191720 CTGTTTATCAAAAGGAATGTGGG + Intronic
1036218147 8:6897713-6897735 CTGTGAATCATAGGACTTGTTGG + Intergenic
1037143759 8:15549014-15549036 GTGTGAATCAAAAAAATTGTAGG + Intronic
1037643301 8:20768436-20768458 CTGTTAAGCAAAAGAATTTAAGG + Intergenic
1038322964 8:26546162-26546184 TTGTTCATCAAAAAAATTGTAGG + Intronic
1038961449 8:32524636-32524658 AAGTTAACCAGAAGAATTGCTGG - Intronic
1041868093 8:62599630-62599652 CTGTAAAAGGGAAGAATTGTAGG + Intronic
1042396845 8:68301650-68301672 CTGTGAATCAGATGGAATGTGGG + Intergenic
1043406688 8:79942631-79942653 CTGGTATTCATAAGAACTGTTGG - Intronic
1044308989 8:90670917-90670939 CTGTTAAAAAGAAGCTTTGTTGG + Intronic
1046369821 8:113287898-113287920 CTTTTAATAATAAGAATTCTAGG - Intronic
1050179511 9:2905106-2905128 GTGTTACCCAGAGGAATTGTTGG - Intergenic
1052029510 9:23612104-23612126 CTGTGAATCAGAAGAGCTGATGG + Intergenic
1053780795 9:41605124-41605146 CTATCAATCAGAAAAAGTGTTGG + Intergenic
1054168738 9:61815281-61815303 CTATCAATCAGAAAAAGTGTTGG + Intergenic
1054668793 9:67765530-67765552 CTATCAATCAGAAAAAGTGTTGG - Intergenic
1056512227 9:87316807-87316829 CTTTTGTTCAGAAGAAATGTGGG - Intergenic
1056987304 9:91375364-91375386 CTGTTAATCAGCAGCAGTGCGGG + Intergenic
1186086100 X:5992436-5992458 CAGTTAATTAAAAAAATTGTAGG - Intronic
1186988790 X:15045540-15045562 CTCTACATCAGAAAAATTGTTGG + Intergenic
1187121031 X:16406607-16406629 CTGTGAAACAGAAGAATAGAGGG + Intergenic
1194012568 X:88581187-88581209 TTAGAAATCAGAAGAATTGTGGG - Intergenic
1194925879 X:99822446-99822468 CTGTGAAACAGAAGCATCGTAGG + Intergenic
1195268389 X:103206436-103206458 CTGTTACACAGAGCAATTGTGGG + Intergenic
1200835951 Y:7731363-7731385 CTTTTAATCACAAGACTTATTGG + Intergenic
1200976926 Y:9221699-9221721 CTGTAAATCAGAAGGATTTTAGG - Intergenic
1202134160 Y:21644276-21644298 CTGTAAATAAGAAGGATTTTAGG + Intergenic
1202191040 Y:22244968-22244990 TTGTTAATCAAATGAAGTGTTGG - Intergenic