ID: 931350054

View in Genome Browser
Species Human (GRCh38)
Location 2:61479552-61479574
Sequence AGGTGTATATACTTAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931350054 Original CRISPR AGGTGTATATACTTAGGGGA TGG (reversed) Intronic
908971505 1:69839651-69839673 AAATGTATATATTTAGGTGAAGG - Intronic
914765975 1:150638211-150638233 GGGTATATATACCTAGGAGAGGG - Intergenic
916169229 1:161988272-161988294 AGGTTTATATGCTGAGGGGAAGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957093 10:1547552-1547574 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957135 10:1547771-1547793 TGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1066014345 10:31223709-31223731 ATGTATATATACTTAAAGGATGG - Intergenic
1066490519 10:35889640-35889662 AGGTGTATCTGCTTTAGGGAAGG + Intergenic
1067819989 10:49520035-49520057 AGTTGTATGTACACAGGGGAGGG - Intronic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1079534471 11:21495510-21495532 GGGTGTGTATACTTAGGAGTGGG + Intronic
1079807278 11:24948972-24948994 AGGTGTATATATTTATGGGGTGG - Intronic
1080636381 11:34127451-34127473 GGATGTATATACTATGGGGAAGG - Exonic
1091521789 12:1252900-1252922 GTGTATATATGCTTAGGGGATGG + Intronic
1091971245 12:4788752-4788774 AGGTGAATTTCCTTACGGGAGGG + Intronic
1094126292 12:27025788-27025810 AGGTGTATTTAATTTGGAGATGG + Intronic
1096103446 12:48982911-48982933 AGGTGCATATACTTGGTGAATGG + Intergenic
1097569259 12:61311356-61311378 AGGTGTATATATTTATGGGGGGG - Intergenic
1099665179 12:85619521-85619543 AGGTGTACCTGCTTTGGGGAGGG + Intergenic
1100155819 12:91799113-91799135 ATGTGTGTATATATAGGGGATGG - Intergenic
1101266519 12:103093958-103093980 TGGTCTGTATACTTAAGGGAGGG + Intergenic
1106708178 13:32303483-32303505 AGTTGTGTATACTTGGAGGAAGG + Intergenic
1106838529 13:33661838-33661860 ATGTGTATCTACGTATGGGAGGG + Intergenic
1109156759 13:58921089-58921111 AAGGATATATACTTTGGGGAAGG + Intergenic
1112322014 13:98416476-98416498 AGGTGTGTTTACTCAGGAGAAGG - Intronic
1113125812 13:106977915-106977937 CATTGTATATACTTAGGGTAGGG + Intergenic
1115786596 14:36833580-36833602 ATGTGTATCTACTTAGGAAAGGG + Intronic
1116530790 14:45970911-45970933 AAGTGTGTATACTTAGTGAAAGG + Intergenic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1118109174 14:62696618-62696640 AGTTGTAAAAATTTAGGGGAAGG + Intergenic
1118731712 14:68671399-68671421 AGGTGAATCCACATAGGGGAGGG - Intronic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1121374257 14:93392391-93392413 AGGGATACATACTTATGGGAAGG + Intronic
1128886168 15:71290016-71290038 ATGTGTATCTACTCTGGGGAAGG - Intronic
1130804988 15:87310701-87310723 TGGTTTATATACTTAGGGTCAGG + Intergenic
1132073444 15:98799662-98799684 AGGAGTGTTTACTTAGCGGAGGG + Intronic
1133295103 16:4747794-4747816 AGGTGCATGAACTTAGAGGAAGG + Intronic
1134646748 16:15874659-15874681 AGGTGTATATATTTGTGGGGAGG + Intronic
1140748375 16:78000958-78000980 AGGTGTAGATACTAGGGGGTGGG + Intergenic
1141329840 16:83100764-83100786 AAGTGTATACCCTAAGGGGATGG - Intronic
1142655994 17:1394631-1394653 AGGTGTATGTATTTATGGGAAGG - Intronic
1144543707 17:16172135-16172157 AGGTATATATTCTTTGGGGGTGG - Intronic
1144700716 17:17337000-17337022 AGGGGTATATACCTAGGAGTGGG + Intronic
1145905839 17:28515799-28515821 AGGTGTATACACCTGGGGAATGG - Intronic
1149441278 17:56676489-56676511 ATGTGTATATGCTGGGGGGATGG + Intergenic
1151175557 17:72284988-72285010 AGGTGTTTACACTTGGGGAAGGG + Intergenic
1151426662 17:74035118-74035140 AGGTGGAGATGGTTAGGGGAGGG + Intergenic
1156088983 18:33442216-33442238 AGGTGTGTATACCAAGGGGTAGG - Intergenic
1157024691 18:43828783-43828805 AGGTGTATTTAACTGGGGGAGGG + Intergenic
1159860580 18:73643962-73643984 TTGAGTATATACCTAGGGGAGGG - Intergenic
1162052601 19:8043769-8043791 AGATGTATTTAGTCAGGGGAGGG - Intronic
1163090103 19:15013379-15013401 AGGTGTCTCAACTTGGGGGAGGG - Intronic
1166140781 19:40804019-40804041 AGGTGTGTATATGTGGGGGAAGG + Intronic
1166621711 19:44306752-44306774 AGTTGTGTATATTTAGGGGTCGG + Intergenic
925219976 2:2131132-2131154 AGCTTTTTATACTTAGGGAAAGG - Intronic
926456151 2:13070719-13070741 AGGTGTATTTTTTGAGGGGAGGG + Intergenic
931350054 2:61479552-61479574 AGGTGTATATACTTAGGGGATGG - Intronic
931433818 2:62230686-62230708 AGGTGGAAATATTTCGGGGAGGG - Intergenic
931585965 2:63828445-63828467 AGATATATATTCTTGGGGGAAGG - Intergenic
935043101 2:99453533-99453555 AGGAGTATATACTGAAGGGTGGG - Intronic
935355469 2:102195315-102195337 AGGTCTTTTTACTTAGGGGTAGG - Intronic
938839417 2:135144481-135144503 AGGTGTATGTAAATAGGTGAAGG + Intronic
939367791 2:141257205-141257227 AGGTGAATGTAATTAGGGGTTGG + Intronic
939412711 2:141851328-141851350 TGTTGTACATACCTAGGGGATGG - Intronic
944770333 2:202907840-202907862 GGGTATATATGCTTAGGAGAGGG - Intronic
1172405750 20:34687605-34687627 ATGTGTGTATATTTGGGGGATGG - Intergenic
1177681046 21:24371563-24371585 ATGTATATATACTTAAGGCAAGG + Intergenic
1181422181 22:22809984-22810006 AGGTGTATATGGTTTCGGGAGGG - Intronic
1184023878 22:41839292-41839314 AGATGTAGATACTTAGGAGAAGG + Intronic
960666154 3:120110997-120111019 AGGTGTGTACATTTATGGGAGGG - Intergenic
963545963 3:146658755-146658777 AGGTCTCTATATTGAGGGGAAGG - Intergenic
964719715 3:159759231-159759253 ACGTGTAGATACTTTGGAGATGG - Intronic
970710035 4:18851225-18851247 GGCTGTGTAGACTTAGGGGATGG + Intergenic
971195468 4:24469460-24469482 AGATGTACATCATTAGGGGAAGG - Intergenic
972379933 4:38510191-38510213 AGCTGTAGACACTTAGGGAAGGG + Intergenic
979193650 4:117894164-117894186 ATGTGTATATAGTTATGGCAAGG - Intergenic
982175510 4:152702125-152702147 ATGTGTAAATACTTAATGGATGG + Intronic
982895767 4:160922474-160922496 ACATGTATATTTTTAGGGGAAGG + Intergenic
984099470 4:175468085-175468107 AAATGTATATATATAGGGGAGGG - Intergenic
984395428 4:179192006-179192028 AAGTGTATATACCTAGGAGTGGG + Intergenic
984505682 4:180615241-180615263 AGGTGTGTATTCTTAGAGTAGGG + Intergenic
986209085 5:5653240-5653262 AGGGGTATATGCCTAGGGGTGGG + Intergenic
986542084 5:8855280-8855302 AGTTGTATATCCTGAGTGGAAGG - Intergenic
987295050 5:16542554-16542576 AGCTGTGTTTACTTAGGGAATGG - Intronic
987528961 5:19091375-19091397 ATCTGTATATACTCAGGAGATGG + Intergenic
990923239 5:60991798-60991820 TGGGGTATGTACCTAGGGGAGGG + Intronic
991080880 5:62597937-62597959 AGGTTAATATGCTGAGGGGATGG - Intronic
996469128 5:123839094-123839116 AGGTGTATATATTTATGAGGAGG - Intergenic
998493494 5:142566902-142566924 AGGTCAATAGACTTAAGGGAGGG + Intergenic
999178306 5:149647784-149647806 AGGTGTATAAACTTCAGGCATGG - Intergenic
1004403746 6:15312462-15312484 AGGTGCATATATTGATGGGATGG - Intronic
1004704776 6:18114288-18114310 GGGTGTATATACCTAGGAGTGGG - Intergenic
1004795478 6:19078786-19078808 TGGTGTATATACATAGGCAATGG + Intergenic
1005216549 6:23534694-23534716 AGGTTCATGTACTGAGGGGAAGG + Intergenic
1005969170 6:30747883-30747905 AGATGGATATCATTAGGGGAAGG + Intergenic
1016352557 6:143183806-143183828 AGGTCTTTATGTTTAGGGGAGGG + Intronic
1021176194 7:17452370-17452392 ATGTGTATATACCAAGGGAAAGG + Intergenic
1023533388 7:41182837-41182859 AGTTGTTTATAATTAGAGGAAGG + Intergenic
1024498830 7:50078501-50078523 AGGTGTATATATGTATGGGGTGG - Intronic
1028139048 7:87252201-87252223 ATGTGTGTAGACTGAGGGGAAGG + Intergenic
1028186022 7:87785734-87785756 AGATGGAGAGACTTAGGGGATGG + Intronic
1032590105 7:133183940-133183962 GTGTGTATATATTTGGGGGAGGG - Intergenic
1032729709 7:134627654-134627676 AGGGGTATATACCTAGGAGCAGG + Intergenic
1033774000 7:144586749-144586771 TGGTGTGCATACTTTGGGGAAGG - Intronic
1035180622 7:157086729-157086751 GTGTGTATATACATAGGGGTGGG - Intergenic
1036558631 8:9883248-9883270 AGGTGTAGATACTTTGGGAATGG + Intergenic
1037494586 8:19426273-19426295 GGGTGTATATACACAAGGGAGGG - Intronic
1038001383 8:23394739-23394761 GGGGGTATATACTTAGGAGGGGG - Intronic
1039214604 8:35256078-35256100 GTGTGTATACACATAGGGGAAGG - Intronic
1039260069 8:35761834-35761856 AGATGTAAGCACTTAGGGGAGGG + Intronic
1039348464 8:36734210-36734232 AGGTGGAGATCATTAGGGGAAGG + Intergenic
1050564685 9:6869719-6869741 AGGGGTATGTTCTTGGGGGAGGG + Intronic
1051227576 9:14918073-14918095 AGATGTATATAAAAAGGGGAGGG + Intergenic
1062577648 9:137216016-137216038 AGGTGTGTATGCTCAGGGGCTGG + Exonic
1186929065 X:14368124-14368146 AGCTGTATATATTTAAGGTATGG + Intergenic
1187321633 X:18243982-18244004 AAGTATATTTACCTAGGGGAAGG + Intronic
1187533778 X:20118909-20118931 AGGTGTTTATAATTAGGGAGAGG - Intergenic
1187789137 X:22929527-22929549 ATATGTATTTATTTAGGGGATGG - Intergenic
1189029227 X:37432870-37432892 AAGTGTAGATATTTGGGGGAAGG - Intronic
1194011732 X:88569981-88570003 AGGTGTATCTACATATGGTAAGG + Intergenic
1196578630 X:117352482-117352504 AGGTTTGTATACTTATGGGGCGG + Intergenic
1199270793 X:145880724-145880746 AGTTGAATATATTTGGGGGAGGG + Intergenic
1199808578 X:151326992-151327014 CTTTGTATTTACTTAGGGGAGGG + Intergenic
1201771505 Y:17620979-17621001 AGGTGTATATACTCATGGCTTGG + Intergenic
1201830050 Y:18285007-18285029 AGGTGTATATACTCATGGCTTGG - Intergenic