ID: 931351395

View in Genome Browser
Species Human (GRCh38)
Location 2:61491959-61491981
Sequence CTGTATGTATCAATGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931351395 Original CRISPR CTGTATGTATCAATGGAAAT AGG (reversed) Intronic
909148232 1:71965570-71965592 CTTTATTTATTCATGGAAATGGG + Intronic
910134148 1:83946650-83946672 CTTTATGTAGCCATGGTAATTGG - Intronic
911879168 1:103212144-103212166 CTTTATCCATCAATGGACATGGG - Intergenic
912106001 1:106276431-106276453 CTGAATATATTAATAGAAATTGG - Intergenic
912583283 1:110738642-110738664 ATGTATATATCAATAAAAATTGG - Intergenic
913377847 1:118174044-118174066 CTGTATGCCTCATTGAAAATTGG - Intronic
917673636 1:177299057-177299079 TTGGATGTATTAATGGAATTTGG - Intergenic
918516541 1:185369763-185369785 CTATATGGATCAAATGAAATTGG - Intergenic
919657364 1:200210646-200210668 CTGTTTATATGAATGGAAATTGG + Intergenic
920809562 1:209269666-209269688 CAGTATGTAAAAATGAAAATTGG - Intergenic
922622200 1:226998035-226998057 CTGTTTGTAGCAATTGTAATGGG - Intronic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1063809645 10:9690250-9690272 GTGTATGTATGACTTGAAATAGG - Intergenic
1066651853 10:37663958-37663980 CTGAATGTATAAAAGTAAATTGG + Intergenic
1068290023 10:54989642-54989664 CTGTATTTACCCATTGAAATGGG + Intronic
1068550479 10:58402754-58402776 CTTAATGTATGAATGGAGATTGG + Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1069130152 10:64690255-64690277 CCGTAGGTGTCAATGCAAATGGG - Intergenic
1069196594 10:65558423-65558445 TTGTATGTATAAATAAAAATTGG - Intergenic
1069643734 10:69975442-69975464 CTGTATGTGTGATTGGAAAACGG + Intergenic
1070577544 10:77690825-77690847 GGGGATCTATCAATGGAAATGGG - Intergenic
1073205422 10:101766896-101766918 CTGAATGAATGAATGGAATTAGG + Intergenic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078943418 11:16034946-16034968 CTGTTTGTATCTATAGAAGTGGG - Intronic
1079667338 11:23122220-23122242 CTTTTTGTAGCAATGGAAACAGG + Intergenic
1080738165 11:35037722-35037744 CTGCAGGTATACATGGAAATAGG + Intergenic
1081256227 11:40898933-40898955 ATGTATGTATCTAAGGAAATAGG - Intronic
1081849331 11:46264313-46264335 CTGTATGTATCATTTTAAAGGGG - Intergenic
1086894083 11:92292132-92292154 GTGTATTTATTAATGGATATTGG + Intergenic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1088381646 11:109199906-109199928 GCGTATGAATAAATGGAAATGGG - Intergenic
1090493757 11:127190088-127190110 TGGTATGTTTGAATGGAAATGGG + Intergenic
1093188075 12:16044740-16044762 TTCTATGAATCAATGGAGATAGG - Intergenic
1094195161 12:27741518-27741540 CTGTATATATTAATAGAAATTGG - Intronic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1098162685 12:67661032-67661054 CTTTATTTATAAATGGAAACCGG + Exonic
1098168329 12:67720084-67720106 ATGAATGTGTAAATGGAAATAGG + Intergenic
1098666914 12:73175869-73175891 CTGTATTTATAACTGGAAATAGG - Intergenic
1100564821 12:95785598-95785620 CTCCATGTATCTATGGAAGTGGG + Intronic
1101770262 12:107743451-107743473 CTTTATGTATTGCTGGAAATAGG - Intronic
1103178533 12:118886714-118886736 CTGTAGTTATCAGTGTAAATTGG + Intergenic
1109510802 13:63369798-63369820 CTGTAAGTGCCAATGTAAATAGG - Intergenic
1110525822 13:76535693-76535715 CTGTTTGTGTGAATGTAAATTGG + Intergenic
1113719662 13:112545282-112545304 GTGTATGTAGCTATTGAAATAGG - Intronic
1115406172 14:33019616-33019638 CTGTGTGCATCATTGGAACTAGG + Intronic
1120062304 14:79998702-79998724 AAATATGTATCAATGGAAAATGG + Intergenic
1120313139 14:82857089-82857111 CTGTGTGTGTCACTGGAAGTAGG + Intergenic
1120622837 14:86786920-86786942 ATATATGTATAAAAGGAAATAGG + Intergenic
1124197322 15:27643484-27643506 CTGTTTGTATCAATTGTAAATGG - Intergenic
1126401520 15:48276147-48276169 CTGGATGAGCCAATGGAAATGGG + Intronic
1127384373 15:58455123-58455145 CTGTATTTATACATGGACATTGG + Intronic
1129950962 15:79590953-79590975 CTGTATGAATCAATGGGCAATGG - Intergenic
1131067884 15:89445586-89445608 ATGTATATATCAATGGAAGAAGG - Intergenic
1131615353 15:94011272-94011294 TTATATGTATTAATGAAAATGGG - Intergenic
1133647959 16:7781991-7782013 CTGTATGTTTTAGTAGAAATGGG + Intergenic
1136925641 16:34371002-34371024 CTGGATGCCTCAATGGAACTGGG + Intergenic
1136978933 16:35040804-35040826 CTGGATGCCTCAATGGAACTGGG - Intergenic
1139225086 16:65226966-65226988 CTGTATTCGTCAAAGGAAATTGG + Intergenic
1140346281 16:74216029-74216051 CAGGATGTCTCAAAGGAAATGGG + Intergenic
1141319580 16:82994692-82994714 ACGTAGGTATCAATGGAGATTGG - Intronic
1146086694 17:29837411-29837433 TGGTATCTATCACTGGAAATTGG - Intronic
1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG + Intergenic
1155026034 18:21941801-21941823 GTGTATTTTGCAATGGAAATGGG + Intergenic
1155523623 18:26694280-26694302 CTGTATATCTCCATGCAAATTGG - Intergenic
1156512996 18:37657004-37657026 CTGTGTGTATCAAAGAAAGTTGG - Intergenic
1156595201 18:38540888-38540910 CTGCTTGAATCAATGAAAATGGG + Intergenic
1157395140 18:47335175-47335197 CAGTATGTTGCAATGGAAACTGG + Intergenic
1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG + Intronic
1159308448 18:66676906-66676928 CTGTTTTAATCAATGGATATTGG + Intergenic
1159333293 18:67029944-67029966 CTGTTTGAAACAAGGGAAATAGG - Intergenic
1159972107 18:74667358-74667380 CTGTATGTACTATTGGAAACTGG - Intronic
1160164572 18:76498665-76498687 TTTTGTGTATAAATGGAAATTGG + Intergenic
1161051236 19:2164900-2164922 CTTTATTTATCCTTGGAAATTGG + Intronic
1163016766 19:14460692-14460714 GTGTATCTATCAATGGATAGAGG - Intronic
1167098091 19:47386176-47386198 CTGTATGTATCCAGGGTTATAGG + Intergenic
1168205647 19:54848716-54848738 CTGTATCTTTGGATGGAAATTGG - Intronic
1168383364 19:55942889-55942911 CTGTATGTATTTATGGAAAGCGG + Intergenic
928702382 2:33912165-33912187 CTGTATTTATCCATGGACCTTGG + Intergenic
930211603 2:48644633-48644655 CTGTTTGTATGAATGTATATTGG - Intronic
930708758 2:54530249-54530271 GTTTATGTATCTAAGGAAATAGG + Intronic
931351395 2:61491959-61491981 CTGTATGTATCAATGGAAATAGG - Intronic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
934149156 2:89128877-89128899 CTGCAGGTACCAATGCAAATAGG + Intergenic
934163476 2:89273648-89273670 CTGTATGTATGAAGTGCAATAGG + Intergenic
934203798 2:89908876-89908898 CTGTATGTATGAAGTGCAATAGG - Intergenic
934789498 2:97046694-97046716 CTGCAGCTATCAATGTAAATAGG - Intergenic
935696838 2:105777496-105777518 CTGTATGGATCAATGGAAATGGG + Intronic
938222613 2:129583389-129583411 TTTTATGTATCTATGGAGATTGG + Intergenic
938572566 2:132573547-132573569 ATGTCTGTCTCAATGGAAAGTGG - Intronic
938717117 2:134030745-134030767 TTGTATGAGTCTATGGAAATGGG - Intergenic
939274228 2:139979252-139979274 GTCTGTGTATCCATGGAAATCGG + Intergenic
940602485 2:155879641-155879663 TTGTATGTTTCATTGGATATAGG - Intergenic
941617813 2:167741265-167741287 TTGTAAATATCAATGTAAATTGG + Intergenic
942354059 2:175088349-175088371 CAGTATTTATCACTTGAAATAGG - Intronic
942800544 2:179870281-179870303 CTGAATGCAACAAGGGAAATTGG - Intergenic
943705661 2:191031314-191031336 CCTTATGTATTAAAGGAAATGGG + Intronic
944791534 2:203134125-203134147 CTGTTTGTATAAATGTAAACTGG - Intronic
944982609 2:205138713-205138735 CTGTATATATGAATGGGAATGGG + Intronic
945288776 2:208108059-208108081 TTGCATGTATCAGTGGAAAGGGG - Intergenic
945381693 2:209147830-209147852 TTGCATGTATCAGTGGAAAGGGG + Intergenic
946109440 2:217401375-217401397 CTGTCTGTGTCATTGTAAATAGG + Intronic
948292820 2:236839291-236839313 TTGTATGTAACTATGTAAATTGG - Intergenic
1174773871 20:53325709-53325731 GTTTTTGTACCAATGGAAATAGG + Intronic
1177560797 21:22750095-22750117 TTGTATGTATAAATTTAAATAGG - Intergenic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
1178744403 21:35234409-35234431 CAGTATGTATTAATGGACACAGG - Intronic
949143819 3:670356-670378 CTGTATGTATCAGTGAGATTTGG + Intergenic
950342402 3:12258899-12258921 CTGTTGGTGGCAATGGAAATTGG + Intergenic
951394136 3:22143519-22143541 GTGTATGAATCAATAGAAATAGG - Intronic
953181685 3:40600909-40600931 CTCTATGTATCAGTGGACATGGG + Intergenic
955113066 3:55968920-55968942 CTTTATGTAGCAAGGGGAATGGG - Intronic
955633716 3:61002772-61002794 CTGCATCTATCACTGGAAAGTGG + Intronic
956237114 3:67084529-67084551 TTGTATTTATTAATAGAAATGGG - Intergenic
956704818 3:71990397-71990419 CTGTTTGTGGCAATGGAAAGGGG + Intergenic
956953281 3:74307492-74307514 CAGTGTGTATCAAATGAAATAGG + Intronic
957143357 3:76389755-76389777 ATGTATGTAACAAAGGAAAGTGG - Intronic
959627972 3:108473986-108474008 TTGTATTTCTCAATGGTAATTGG - Intronic
959688410 3:109172357-109172379 GTGCATGTATGACTGGAAATGGG - Intergenic
959949988 3:112169468-112169490 ATGTGTCTATCAATGAAAATTGG + Intronic
961586532 3:127932345-127932367 CTGTATATATAATTGGAATTCGG + Intronic
963180563 3:142351163-142351185 ATCTATCTATCTATGGAAATGGG + Intronic
965546015 3:169917106-169917128 ATGTATGTATGAATGGCAAAAGG + Intronic
965599779 3:170443179-170443201 CTGTATGTAGCTAGGGAAATTGG + Intronic
966124987 3:176565315-176565337 CTGCATCTATCATTGGAAAACGG - Intergenic
970136222 4:12927348-12927370 CTGTATGTATCATTGTTATTCGG + Intergenic
974226681 4:59054316-59054338 ATGTATGTAATAATGGAAAGTGG + Intergenic
976124202 4:81816173-81816195 CTGTATGTAGTCATAGAAATAGG - Intronic
977441536 4:97074000-97074022 ATTTCTGTATCAATCGAAATAGG - Intergenic
982006494 4:151068460-151068482 TTGTATTTTTCAATGGAGATGGG + Intergenic
983533559 4:168833836-168833858 CTGTTTAGATCAATGGATATAGG + Intronic
984513845 4:180713881-180713903 CTGTATTCATGAACGGAAATGGG - Intergenic
985160372 4:187037965-187037987 CTCCATGTTTCAAAGGAAATTGG - Intergenic
985235972 4:187874833-187874855 CTGTATGTATAAGTACAAATTGG + Intergenic
985985225 5:3510251-3510273 ATGTAGGTGTGAATGGAAATAGG - Intergenic
987452975 5:18109088-18109110 CTGTATGTATACATGCATATGGG + Intergenic
987638836 5:20584818-20584840 ATTTATCTGTCAATGGAAATGGG - Intergenic
988571329 5:32369941-32369963 GTGCATGTCTCTATGGAAATAGG - Intronic
990577495 5:57137281-57137303 AAGTATGTATCAATTGAAACAGG + Intergenic
991936653 5:71808557-71808579 CTGTAGGTATCACTGAAAAGTGG + Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
996862222 5:128080602-128080624 CAGTGGGTATCAGTGGAAATGGG - Intergenic
1001735928 5:174001340-174001362 CTGTATTTAAGAAAGGAAATAGG - Intronic
1002785283 6:395219-395241 CTGTATGCCTCAATGTATATGGG + Intronic
1004352895 6:14906008-14906030 CTTTATGAATAAATGGTAATGGG + Intergenic
1005384921 6:25276722-25276744 CTGTATGTTTCAAAAGAGATGGG + Intergenic
1008325148 6:50170305-50170327 CTGTTTGTTACAATGTAAATTGG + Intergenic
1009440104 6:63667710-63667732 CAAAATGTATCAATGGAAAAAGG - Intronic
1011486888 6:87852008-87852030 CTGTATGTCTCATAGAAAATTGG - Intergenic
1012410926 6:98956178-98956200 TTGTATGTTTCAAAGGAGATGGG - Intergenic
1012492544 6:99798272-99798294 ATGTATGAAACAATGGACATGGG - Intergenic
1016533769 6:145088762-145088784 CAGAATGTATCAATGAAATTAGG + Intergenic
1019869832 7:3749917-3749939 CTGTGTGAATCAATATAAATTGG + Intronic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1021128953 7:16887556-16887578 CTGACTATATCAGTGGAAATGGG - Intergenic
1022202961 7:28135837-28135859 CTGTTTGTATCTATGTAACTAGG + Intronic
1022732642 7:33044664-33044686 ATGTCTTTATCAATGGAAAAAGG + Intronic
1024446202 7:49482656-49482678 TTTTATGTATAAATGGATATAGG + Intergenic
1027564916 7:79779638-79779660 ATGTATGTATTTATGGAGATGGG + Intergenic
1028289954 7:89053037-89053059 TTGTATGTATCAAGAGAAGTTGG - Intronic
1028328990 7:89564650-89564672 CTGTGGGTGCCAATGGAAATTGG + Intergenic
1029050837 7:97685289-97685311 CTCAATGTGTCGATGGAAATAGG - Intergenic
1029121123 7:98269089-98269111 TTGTATGTTTCCATGGAAAAGGG + Intronic
1029927482 7:104332536-104332558 CTTAATGTATCACTTGAAATAGG - Intronic
1029994839 7:104997254-104997276 GTGTATGTTTCCATAGAAATAGG - Intergenic
1040691780 8:49947482-49947504 ACGTGTGTATCAGTGGAAATGGG - Intronic
1044433204 8:92133148-92133170 CTGTATATACCATTGGAAATGGG - Intergenic
1045161644 8:99554125-99554147 TTCCATGTATCAAGGGAAATAGG + Intronic
1045365114 8:101468915-101468937 CTCTATTTACAAATGGAAATTGG - Intergenic
1045887678 8:107118937-107118959 CTGTATGGGAAAATGGAAATGGG - Intergenic
1045890455 8:107150595-107150617 CTGCCTGTGTAAATGGAAATGGG + Intergenic
1046805775 8:118477629-118477651 TTGTAAGTCTCAATGGACATTGG + Intronic
1048103738 8:131384031-131384053 CTCTTTGTATAAATGTAAATGGG - Intergenic
1050241050 9:3635813-3635835 GTGGATGTATAAATGAAAATGGG + Intergenic
1051919375 9:22246825-22246847 CTCTTTATATCAATTGAAATGGG + Intergenic
1052169784 9:25378617-25378639 CTCTATGTATCTATATAAATAGG + Intergenic
1053534075 9:38908396-38908418 CTTTATTTATCACTGGAGATAGG + Intergenic
1053557862 9:39156890-39156912 ATGTATATATTTATGGAAATGGG + Intronic
1053821976 9:41977176-41977198 ATGTATATATTTATGGAAATGGG + Intronic
1054139252 9:61462061-61462083 ATGTATATATTTATGGAAATGGG - Intergenic
1054206299 9:62132815-62132837 CTTTATTTATCACTGGAGATAGG + Intergenic
1054608597 9:67210232-67210254 ATGTATATATTTATGGAAATGGG - Intergenic
1054632058 9:67455531-67455553 CTTTATTTATCACTGGAGATAGG - Intergenic
1054755426 9:68952722-68952744 CTGGATTTCTCAATGGTAATTGG - Intronic
1059826290 9:118032802-118032824 CTGTATGGATCCAAGGAACTGGG + Intergenic
1186251819 X:7676137-7676159 CTATATGTATACATGGAAACCGG + Intergenic
1189914255 X:45841412-45841434 CTGTATATAGCCTTGGAAATTGG - Intergenic
1193258025 X:79372768-79372790 TAGCATCTATCAATGGAAATAGG + Intergenic
1194773516 X:97934106-97934128 CTGTAGGTCACAATGGAAAATGG + Intergenic
1196550821 X:117022541-117022563 CTGGAAGAATCAATGGAAATTGG + Intergenic
1200308264 X:155051121-155051143 CTGTTTTTATCAAGGGAAATAGG + Intronic