ID: 931355785

View in Genome Browser
Species Human (GRCh38)
Location 2:61537305-61537327
Sequence TTCGCGTGTGCGGGTGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931355785_931355792 5 Left 931355785 2:61537305-61537327 CCACCGCCACCCGCACACGCGAA 0: 1
1: 0
2: 0
3: 5
4: 118
Right 931355792 2:61537333-61537355 CAGCAAGCGCTCCCCTCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931355785 Original CRISPR TTCGCGTGTGCGGGTGGCGG TGG (reversed) Intronic
900087339 1:904799-904821 TTTGTGTTTGCGGGAGGCGGCGG - Intergenic
903176999 1:21587308-21587330 TTGAGGTGTGGGGGTGGCGGTGG + Intergenic
904244969 1:29181448-29181470 TGCGCGGGTGGGGGTGGTGGAGG - Intronic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904419043 1:30379663-30379685 TTCGTTAGTGAGGGTGGCGGGGG + Intergenic
905173318 1:36121952-36121974 GTCACATGTGGGGGTGGCGGAGG - Intronic
909931104 1:81501657-81501679 TCCGGGTTTTCGGGTGGCGGAGG - Intronic
922168826 1:223138128-223138150 TTTGTGTGTGGGGGTGGGGGTGG + Intronic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
924625261 1:245692209-245692231 TTCTGGTGTGTGGGTGGAGGTGG + Intronic
1062987738 10:1785181-1785203 TTAGCATGTGCTGATGGCGGGGG + Intergenic
1063692740 10:8302765-8302787 TTCTTGTGTGCGGGAGGTGGAGG + Intergenic
1069438382 10:68406833-68406855 TTCAGGTTTGGGGGTGGCGGAGG - Exonic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1072555989 10:96513918-96513940 TGCGAGTGTGGCGGTGGCGGCGG + Intronic
1072891485 10:99329250-99329272 CGCGCGTGGGCTGGTGGCGGTGG - Exonic
1074332062 10:112523575-112523597 TGTGTGTGTGTGGGTGGCGGGGG + Intronic
1081028325 11:38044676-38044698 TTTGTGTGTGCAGGTGGGGGAGG - Intergenic
1084527038 11:69704123-69704145 TGGGTGTGTGCGGGGGGCGGAGG - Exonic
1088867794 11:113865225-113865247 TTTGTGTGTGCGTGTGGCTGGGG + Intronic
1089507299 11:118972162-118972184 TTCGCGAGTGGGGGTGGAGCGGG - Intronic
1089615476 11:119692420-119692442 TGTGTGTGTGTGGGTGGCGGGGG + Intronic
1094849901 12:34377649-34377671 TTTGCCTGTGGGGGTGGGGGTGG + Intergenic
1097943207 12:65335609-65335631 TTTGTGTGTGTGTGTGGCGGGGG + Intronic
1102490599 12:113287723-113287745 TTGGCGTGTGGGGGTGGCCTGGG + Intronic
1104097956 12:125576877-125576899 TTTGCGTGTGTGTGTGGCAGGGG + Intronic
1104798244 12:131534738-131534760 TTCCCGTGTGGGAGTGGGGGTGG - Intergenic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113660862 13:112105575-112105597 TGCGCGGGTGCGGGAGGCGGAGG + Intergenic
1122543287 14:102509465-102509487 TGCGCGTGTGCCGGAGGAGGAGG + Intronic
1123121395 14:105918586-105918608 GTGGGGTGTGCGGGGGGCGGTGG + Intronic
1131290150 15:91100185-91100207 TGCGCCTGGGCGGCTGGCGGGGG + Intronic
1132659370 16:1054650-1054672 TTTGTGTGTGTGGGTGGGGGTGG - Intergenic
1133232191 16:4372069-4372091 TGCGTGTGTGCGCGCGGCGGCGG - Intronic
1133950519 16:10387836-10387858 TGTGTGTGTCCGGGTGGCGGGGG - Intronic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1142528329 17:561079-561101 CTCGTGTGTGCTGGTGGAGGAGG + Intronic
1143446326 17:7012391-7012413 TTCCCGTGTGCGGGGGGAGGGGG + Intergenic
1143555328 17:7656260-7656282 TTTGTGTGTGTGTGTGGCGGGGG - Exonic
1144364486 17:14529148-14529170 TTGGCCTGTGGTGGTGGCGGTGG + Intergenic
1144965099 17:19072188-19072210 TTTGGATGTGGGGGTGGCGGAGG - Intergenic
1144982868 17:19179992-19180014 TTTGGATGTGGGGGTGGCGGAGG + Intergenic
1144985355 17:19198247-19198269 TTTGGATGTGGGGGTGGCGGAGG - Intergenic
1147184264 17:38705219-38705241 GGCGCGTGAGCGGGTGGCGCGGG + Intergenic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1150624096 17:66830341-66830363 TTTGTGTGTGGGGGTGGGGGTGG - Intergenic
1152025211 17:77804563-77804585 TGTGTGTGTGTGGGTGGCGGTGG - Intergenic
1152608484 17:81304536-81304558 TGAGAGTGTGCGGGTGGCTGGGG - Intergenic
1160991911 19:1863571-1863593 TGCTCGAGTGCGGGAGGCGGAGG + Intergenic
1161055412 19:2188487-2188509 TGCACCTGTGCGGGTGGGGGGGG - Intronic
1161967676 19:7557296-7557318 CTTGCGTGTGCGGGTGGTGCGGG - Intronic
1162085080 19:8243808-8243830 TTCCCGTGGGCGTGTGGAGGAGG - Intronic
1162251523 19:9448211-9448233 TTTGTGTGTGCGTGTGGCGGGGG + Intergenic
1163696866 19:18768617-18768639 GGCGCCTGTGGGGGTGGCGGGGG - Exonic
1165851561 19:38852570-38852592 TTTCCGTCTGCGGGGGGCGGGGG - Intergenic
1167036648 19:46998895-46998917 TTGGCGTGGGTGGGTGGCAGCGG + Intronic
1168325435 19:55536506-55536528 TCAGGGTGGGCGGGTGGCGGCGG - Intronic
1168408018 19:56120859-56120881 CGCGCGCGTGCGCGTGGCGGGGG - Intronic
1168505002 19:56926394-56926416 TTCGTGTGTGTGGGCGGGGGGGG + Intergenic
1168714114 19:58517231-58517253 TGCGCAGGTGCGAGTGGCGGGGG + Exonic
927723338 2:25401754-25401776 GTTGCGTGTGCGTGTGGAGGGGG - Intronic
931355785 2:61537305-61537327 TTCGCGTGTGCGGGTGGCGGTGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935638253 2:105267010-105267032 TTGGAGTGTGGGGGTGGTGGGGG + Exonic
941029132 2:160492802-160492824 ATCGCGTGCGCGGGAGGTGGAGG + Intronic
1172702735 20:36863074-36863096 TGCGGGTGTGCGGGTGGCCGGGG - Exonic
1173521703 20:43704829-43704851 TTGTAGTGTGCTGGTGGCGGTGG - Intronic
1173645842 20:44632639-44632661 TTCGCTTGTGTGGGTGGCCAGGG - Intronic
1174452406 20:50628501-50628523 TGCGCGTGTGCAGATGGGGGTGG - Intronic
1174760253 20:53200164-53200186 TTCTTGTGGGCGGGTGGAGGGGG + Intronic
1175372541 20:58501670-58501692 TTCCCCTGTGCGTGTGGAGGTGG - Intronic
1175605567 20:60309772-60309794 TTCACTTGTGCAGGGGGCGGTGG + Intergenic
1175856143 20:62122126-62122148 TGCGCGTGGGCGGGCGGCTGCGG - Intergenic
1176857178 21:13982152-13982174 CTCGGGGGTGCGGGTGGGGGGGG + Intergenic
1178194063 21:30322388-30322410 TTCTCGTGTGTGTGTGGGGGGGG + Intergenic
1184779454 22:46639563-46639585 TGTGTGTGTGCGTGTGGCGGTGG + Intronic
949105866 3:198387-198409 TTTGCGCGTGCGCGTGGCGATGG + Intronic
949836976 3:8280069-8280091 TTTGTCTGTGGGGGTGGCGGGGG + Intergenic
960572393 3:119198086-119198108 TTTGTGTGTGAGGGTGGGGGTGG - Intronic
967035571 3:185646271-185646293 GGTGCGTGTGTGGGTGGCGGGGG + Intronic
968024360 3:195426927-195426949 TTGGTGGGGGCGGGTGGCGGGGG - Intronic
969037794 4:4269378-4269400 TTTGCTGGTGCGGGTGGGGGTGG - Intronic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
970754898 4:19413886-19413908 TTTGTGTGTGTGTGTGGCGGGGG - Intergenic
975326944 4:73069445-73069467 TTCGCCGGTGCGGGTTGCGGAGG - Exonic
978619337 4:110622969-110622991 TGTGCGTGTGCGCGTTGCGGAGG - Exonic
978980393 4:114937874-114937896 TACGTGTGTGTGTGTGGCGGGGG + Intronic
979279255 4:118846902-118846924 TCCGTGTGTGTGGGTGGAGGTGG - Intergenic
986396675 5:7337648-7337670 TTGGTGTGTGCAGGTGGCAGAGG - Intergenic
992492505 5:77259077-77259099 TTCGTGTGTGTGTGTGGGGGGGG - Intronic
996542495 5:124645493-124645515 TGTGTGTGTGTGGGTGGCGGTGG + Intronic
999159260 5:149481861-149481883 TTGGGGTGTGCAGGTGGGGGCGG - Intergenic
1001529882 5:172454380-172454402 AGCGCGGGTGCGGGTGGCGCGGG + Exonic
1002711060 5:181195306-181195328 GTCGCGCGTGCGGGTGGCCCTGG - Exonic
1003062841 6:2876113-2876135 TGCGCGTGGGCGGGCGGCCGGGG + Intergenic
1005761962 6:28975737-28975759 TTAGTGTGTGTCGGTGGCGGGGG + Intergenic
1005867640 6:29948183-29948205 TTTGTGTGTGTGTGTGGCGGCGG - Intergenic
1007327312 6:41072584-41072606 TACGCATGCGCGGGCGGCGGCGG - Exonic
1007411480 6:41664585-41664607 TTGGCGTGTGGTGGTGGTGGGGG - Intergenic
1007761095 6:44134226-44134248 TGAGAGTGTGGGGGTGGCGGCGG + Intronic
1012910673 6:105113936-105113958 TTTGTGTGTGTGTGTGGCGGGGG - Intronic
1018046238 6:159969006-159969028 GTCACGTGAGCGGGGGGCGGGGG + Intergenic
1019103078 6:169647792-169647814 TACACGTGTGCAGGTGGGGGCGG + Exonic
1019213007 6:170421657-170421679 GTCCAGTGTGCGGGAGGCGGAGG + Intergenic
1019213022 6:170421719-170421741 GTCCAGTGTGCGGGAGGCGGAGG + Intergenic
1028188344 7:87816417-87816439 TTCTCGTGTGTGTGTGGGGGGGG + Intronic
1029087600 7:98023431-98023453 TTTGGGTGTGTGTGTGGCGGGGG + Intergenic
1029465145 7:100720685-100720707 TGTGCGTGCGCGGGTGGGGGTGG - Intergenic
1032215286 7:129952696-129952718 TTCCCCCGTGCGGGGGGCGGCGG - Exonic
1033130331 7:138740508-138740530 TTGGGGGGTGGGGGTGGCGGAGG - Intronic
1033214204 7:139482353-139482375 TTCGGGAGTGCGGGTAGGGGAGG + Intronic
1034800592 7:154053072-154053094 TTCTCGGGGGCGGGGGGCGGCGG + Intronic
1040312372 8:46243403-46243425 TTGGCGTGGGCGGGTGGCAAAGG + Intergenic
1045788057 8:105946892-105946914 TTTGTGTGTGTGTGTGGCGGGGG - Intergenic
1047961669 8:130016116-130016138 CTCGAGTGCGCGGGGGGCGGCGG - Intronic
1048190223 8:132281694-132281716 TTGGGGTGTGGGGGTGCCGGTGG - Intronic
1053269267 9:36739203-36739225 TTCGTGTGTCGGGGTGGGGGTGG + Intergenic
1059242211 9:112816250-112816272 TCCGCCTGTGCGGGTGGTGTGGG + Intronic
1061242019 9:129380099-129380121 TTGGCGGGGGCGGGGGGCGGCGG + Intergenic
1190475217 X:50820496-50820518 TTGGCGGGGGCGGGGGGCGGGGG - Intergenic
1193472689 X:81926100-81926122 TTCACATGTGCAGGTGGCAGTGG - Intergenic