ID: 931355837

View in Genome Browser
Species Human (GRCh38)
Location 2:61537472-61537494
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3352
Summary {0: 1, 1: 3, 2: 35, 3: 271, 4: 3042}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931355837_931355856 21 Left 931355837 2:61537472-61537494 CCGCCGCCGCCGCGCCCCACGCC 0: 1
1: 3
2: 35
3: 271
4: 3042
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355837_931355846 -2 Left 931355837 2:61537472-61537494 CCGCCGCCGCCGCGCCCCACGCC 0: 1
1: 3
2: 35
3: 271
4: 3042
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931355837 Original CRISPR GGCGTGGGGCGCGGCGGCGG CGG (reversed) Intronic