ID: 931355846

View in Genome Browser
Species Human (GRCh38)
Location 2:61537493-61537515
Sequence CCGGCCTCCTCCCGCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 447}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931355833_931355846 18 Left 931355833 2:61537452-61537474 CCCGGGCTCGCTTCCCGCGGCCG 0: 1
1: 0
2: 2
3: 19
4: 158
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355830_931355846 24 Left 931355830 2:61537446-61537468 CCGCCTCCCGGGCTCGCTTCCCG 0: 1
1: 0
2: 4
3: 38
4: 267
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355836_931355846 4 Left 931355836 2:61537466-61537488 CCGCGGCCGCCGCCGCCGCGCCC 0: 2
1: 19
2: 204
3: 2253
4: 4592
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355839_931355846 -5 Left 931355839 2:61537475-61537497 CCGCCGCCGCGCCCCACGCCGGC 0: 1
1: 0
2: 7
3: 104
4: 903
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355837_931355846 -2 Left 931355837 2:61537472-61537494 CCGCCGCCGCCGCGCCCCACGCC 0: 1
1: 3
2: 35
3: 271
4: 3042
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355831_931355846 21 Left 931355831 2:61537449-61537471 CCTCCCGGGCTCGCTTCCCGCGG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355829_931355846 27 Left 931355829 2:61537443-61537465 CCGCCGCCTCCCGGGCTCGCTTC 0: 1
1: 0
2: 7
3: 93
4: 1797
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355840_931355846 -8 Left 931355840 2:61537478-61537500 CCGCCGCGCCCCACGCCGGCCTC 0: 1
1: 0
2: 8
3: 83
4: 649
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355835_931355846 5 Left 931355835 2:61537465-61537487 CCCGCGGCCGCCGCCGCCGCGCC 0: 1
1: 2
2: 68
3: 627
4: 1802
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355828_931355846 28 Left 931355828 2:61537442-61537464 CCCGCCGCCTCCCGGGCTCGCTT 0: 1
1: 0
2: 1
3: 17
4: 181
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447
931355834_931355846 17 Left 931355834 2:61537453-61537475 CCGGGCTCGCTTCCCGCGGCCGC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 0
2: 6
3: 66
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931355846 Original CRISPR CCGGCCTCCTCCCGCCCGCC CGG Intronic
900094656 1:935410-935432 TCGGCCTCTTCCCGGGCGCCCGG + Intronic
900113673 1:1019931-1019953 CCTCCCTCCCCCGGCCCGCCCGG - Intergenic
900129671 1:1082030-1082052 GTGGCCGCCTCCCGCACGCCAGG - Exonic
900138418 1:1128630-1128652 CCCGCCGCCTTCCGCCGGCCGGG + Intergenic
900244406 1:1630793-1630815 ACGGCCGCCTCCCGCCCCCCAGG + Intergenic
900269214 1:1778557-1778579 CCCGCCGCCTCCCGCCCGCGCGG - Intronic
900322105 1:2089974-2089996 CCGGGCTCCTCACGGCCTCCGGG - Intronic
900346025 1:2210590-2210612 CGGGGCTCCTCCTGCCCTCCGGG + Intronic
900386506 1:2413227-2413249 CCGGCTGCCCCCCACCCGCCAGG - Intronic
900399074 1:2465587-2465609 CCCGCCACCTGCCACCCGCCGGG + Intronic
900643759 1:3699466-3699488 CTGGCCTTCTCCCTCCAGCCTGG - Intronic
900710028 1:4107824-4107846 CCGGCCTCTTCCCCTCCTCCTGG + Intergenic
901059692 1:6466220-6466242 CCCGCCTCCCCCCGCCCGCCAGG - Exonic
901063804 1:6485592-6485614 GCGGACACCTCCCTCCCGCCCGG + Intronic
901242575 1:7704077-7704099 CCGGCCCCCTCCCTCCAGCCTGG + Intronic
901426066 1:9182950-9182972 ACGGCCACCGCCCGCCGGCCCGG + Intergenic
901521807 1:9791054-9791076 TCTGCCTCCTCCCGCCTCCCGGG - Intronic
901526124 1:9824213-9824235 CCGGGCCCCTCCCGGCCGCTCGG - Exonic
901551159 1:9997215-9997237 CGAGCCTCCGGCCGCCCGCCGGG + Exonic
901629830 1:10642669-10642691 CCGCCATCCTCCCGCCTCCCTGG - Intronic
902044415 1:13514060-13514082 CCTGCCCCCTCGCGCCCGCCTGG + Intergenic
903142276 1:21345693-21345715 CCCGCCTGCTCCTGCCCTCCAGG - Intergenic
903225496 1:21892339-21892361 CCGGCCTCCTCGCCCGCGCTGGG - Intronic
903413713 1:23167880-23167902 CCGGCCCCCGCCCAGCCGCCCGG - Intronic
903808657 1:26022441-26022463 CTGGCCTCCTCCTGCCTGGCTGG + Exonic
904058326 1:27686735-27686757 CTGGCCTCCTCCCCTCCCCCCGG - Intergenic
904411852 1:30329448-30329470 CCGACTTCCTCCCGCCCCGCCGG + Intergenic
904618198 1:31761063-31761085 CCGCCCTCCGCCCGCCTCCCCGG + Intronic
904715690 1:32465702-32465724 CCGGCCTCCTCAAACCCTCCAGG - Intronic
905027332 1:34859710-34859732 CCGCTCTCCGCCCGCTCGCCGGG + Exonic
905183179 1:36178829-36178851 CCAGCCGCTTCCCGCCCGCCGGG - Intronic
905515464 1:38558950-38558972 CCCGCCCCCTCCCAGCCGCCTGG + Intergenic
905617032 1:39408653-39408675 CCGCCCTCCTCCCGCTGGCCCGG - Intronic
906430321 1:45750681-45750703 CCCGCCTCGTCACCCCCGCCAGG - Intergenic
906615841 1:47232256-47232278 CCGCCCGCCCCGCGCCCGCCCGG + Intergenic
908119827 1:60975633-60975655 CTGTCCTCCACCCGCCCACCCGG + Intronic
908515076 1:64884134-64884156 AAGGCCTCCTCCTGCCCTCCTGG - Intronic
908780396 1:67685342-67685364 CCGGCCGCCCCTCGCCCGCCCGG - Exonic
909012854 1:70354188-70354210 CCGGCCTCCTCCAATCCCCCCGG - Exonic
910277385 1:85464356-85464378 CCAGCCTCCACCCGCCCTACCGG + Intronic
912471729 1:109911223-109911245 CCGGCCTCCGCCCTGGCGCCAGG - Intronic
912801598 1:112722951-112722973 CCCGCTCCCTCCCGCCCACCCGG - Intronic
912878924 1:113390315-113390337 CGGTCCGCCTCCTGCCCGCCGGG + Intergenic
913250643 1:116909978-116910000 CCTCCCTCCTCCAGCCGGCCGGG - Intergenic
914018051 1:143839342-143839364 CCAGCCTCCTCCCGGAAGCCTGG + Intergenic
914293623 1:146298095-146298117 CCGGCCGCCGCCACCCCGCCGGG - Intergenic
914554667 1:148748878-148748900 CCGGCCGCCGCCACCCCGCCGGG - Intergenic
914656664 1:149747875-149747897 CCAGCCTCCTCCCGGAAGCCTGG + Intergenic
914858729 1:151370009-151370031 CAGCCCTCCTCCCACCCTCCCGG - Intronic
915272083 1:154760632-154760654 CCGGCCTCTCCACGACCGCCTGG + Intronic
915559380 1:156677446-156677468 CGCCCCTCTTCCCGCCCGCCTGG - Intergenic
915629136 1:157138286-157138308 CCGGCCTCGCCTCGGCCGCCGGG - Intronic
916961441 1:169893704-169893726 CCCGCCGCCTCCTCCCCGCCCGG + Intronic
917610639 1:176685669-176685691 CCGGCCCCCTCCTCCCCACCAGG + Intronic
918139854 1:181711075-181711097 CCAGCCTCCTGCAGCCCCCCAGG - Intronic
919861236 1:201740482-201740504 CCCTCCTCCTTCCACCCGCCTGG - Intronic
920458037 1:206116162-206116184 GCCCCCTCCTCCCACCCGCCAGG + Exonic
922518248 1:226223870-226223892 CCCGCCGCCCCCCGCCAGCCTGG + Exonic
923526665 1:234778219-234778241 CCTGCCTCCTCTCGCTCACCTGG - Intergenic
924497681 1:244606217-244606239 CCGGCTTCCTTCCACCCGCCAGG + Intronic
924502927 1:244653395-244653417 CCGGCTTCCTCTCGCCCGTGGGG + Intronic
1062774661 10:135383-135405 CCGGCCTCCTCCCTCCTCCCCGG - Intronic
1064712550 10:18141222-18141244 CGGGCCCCCTCCCGCCCACCCGG - Intronic
1065024535 10:21527319-21527341 CCTGGCTCCTCGCGCCCGCCGGG + Intergenic
1065214829 10:23439373-23439395 CCGGCCCCCTCCCCCGGGCCCGG + Intergenic
1067416310 10:46106117-46106139 CTGGCCCCCTCCCACCCTCCAGG + Intergenic
1068788441 10:61001702-61001724 GCCGCCTCCCCCCGCCCCCCAGG + Intergenic
1069024041 10:63521329-63521351 CCCGCCCCCGCCCGCCGGCCCGG - Intergenic
1069456833 10:68560606-68560628 CCGCGCCCCTCGCGCCCGCCGGG + Intergenic
1069910254 10:71754450-71754472 CTGGCCTCTTCCCGTCTGCCTGG - Intronic
1070780719 10:79136057-79136079 CCTGCCTCCTCCCCCAGGCCTGG + Intronic
1071530505 10:86387751-86387773 GGGGCCTCCTCCCACCCTCCTGG + Intergenic
1071997633 10:91163196-91163218 GCGGCCCCCTCCCGCCCGCCGGG - Intronic
1073035684 10:100562847-100562869 GCCGCCTCCTCCCGCCACCCGGG - Intergenic
1073048635 10:100654263-100654285 CCTGCCGCCTCCAGCCCTCCGGG + Intergenic
1074108758 10:110408156-110408178 CAGGCCTCCTCCAGCCCCTCTGG - Intergenic
1074138053 10:110644551-110644573 CCGGCACCCTCCGGCCCGCGAGG + Exonic
1074971624 10:118543970-118543992 TTGGCCTCCTCCCGCCCCCCGGG - Intergenic
1075961218 10:126568946-126568968 CAGACCTCCTCCTGCCAGCCCGG - Intronic
1076792454 10:132784651-132784673 GCCGCCTCCTCGCGCCTGCCCGG + Intergenic
1076809006 10:132877070-132877092 CCGGCATCCTCCCCACCACCAGG + Intronic
1076874033 10:133207278-133207300 CGGGCCTTCTGCCGGCCGCCCGG - Exonic
1076891506 10:133286567-133286589 GCGTCCTCCTCCCGCGCGCACGG + Intronic
1076977911 11:189490-189512 CGCGCCTCCCCCCGCCCCCCAGG - Intronic
1077060450 11:615622-615644 CCGGCCTGCGCCTTCCCGCCAGG - Exonic
1077343324 11:2035633-2035655 TCGGCATCCTCCCTCCCCCCGGG - Intergenic
1077347965 11:2073079-2073101 CCTGCCTCCTCCTGCCGGCCAGG + Intergenic
1077442398 11:2574832-2574854 TCGGCCTCTTCCCGCCTTCCTGG + Intronic
1078057565 11:8019723-8019745 CCCTCCTCGCCCCGCCCGCCAGG - Intronic
1078561641 11:12377803-12377825 CCCGGCTCCTACCGCCCGCCCGG - Intronic
1079076743 11:17389208-17389230 CCCGCCCCCTCCCGCCGCCCGGG + Intronic
1079129503 11:17739015-17739037 CCAGCTTCCTGCCGCCCGCCCGG + Intronic
1081604748 11:44520319-44520341 CCGGCCTCTGTCCGGCCGCCGGG + Intergenic
1081705579 11:45180663-45180685 GCGCCCGCCCCCCGCCCGCCAGG - Intronic
1081774074 11:45665767-45665789 CCCGCCCCCACCCACCCGCCGGG + Intergenic
1082802865 11:57427156-57427178 TCCGCCCCCTCCTGCCCGCCCGG + Intronic
1083048216 11:59755262-59755284 CCCGCCACCGCCCGGCCGCCCGG - Exonic
1084208874 11:67611758-67611780 CTGGCCTCCTCCAGCCTCCCTGG - Intronic
1084372158 11:68751306-68751328 CCGCCCTCCGCCCACCCGCAGGG + Intronic
1084438476 11:69157476-69157498 CCGGCGGCCTCCCGCCCCCCAGG + Intergenic
1085274102 11:75287285-75287307 CAGCCCTCCTCTCGCCCTCCAGG + Intronic
1085396526 11:76209574-76209596 CCGGCCTCGCCCCGCCCCGCAGG - Intronic
1085409070 11:76281060-76281082 CCGGCCTCCTGCTCCCAGCCAGG + Intergenic
1086261899 11:84949519-84949541 CTGCCCACCCCCCGCCCGCCAGG - Intronic
1088579186 11:111299530-111299552 CCCGCCACCTCCCGCGAGCCGGG + Exonic
1089844998 11:121451810-121451832 CCGGCCTCATCCCCACCTCCAGG - Intergenic
1202826310 11_KI270721v1_random:90822-90844 TCGGCATCCTCCCTCCCCCCGGG - Intergenic
1092187774 12:6493779-6493801 ACGGCCTCCTCCCCGCCGACTGG + Exonic
1092246554 12:6867399-6867421 CCGCCCTCCTGCCGCCGCCCCGG - Exonic
1094486108 12:30926923-30926945 CCGGCTTCCCTCTGCCCGCCCGG - Intronic
1095990005 12:48027947-48027969 CCAGCCTCCTCCTGTGCGCCAGG - Intergenic
1096665256 12:53160101-53160123 CCCACCTCCTCCCGCCTACCGGG + Exonic
1096749837 12:53751715-53751737 CGGGCCGGTTCCCGCCCGCCCGG + Intergenic
1097166474 12:57088990-57089012 ACGCCCTCCGCCCGCCAGCCCGG + Exonic
1098973552 12:76879211-76879233 CCTGCAGCTTCCCGCCCGCCCGG + Intergenic
1100309172 12:93378248-93378270 CCGGCCGCCGCCACCCCGCCGGG - Exonic
1101371754 12:104137668-104137690 GCGCCCTCCTCCCGCCCGCGGGG - Intronic
1102077705 12:110073269-110073291 GCTGCTTCCTCCCTCCCGCCCGG + Intronic
1102101312 12:110281110-110281132 GCTCCCTCCTCCCGCGCGCCTGG - Intronic
1102151075 12:110689322-110689344 CCGGCTGCCTCCCGCCCCGCAGG + Intronic
1102534388 12:113569877-113569899 CCGGCCTCCTCCATCCCGCCGGG - Intergenic
1103532380 12:121611484-121611506 CCAGGCTCCTCCCACCCACCAGG - Intergenic
1103532393 12:121611519-121611541 CCTGGCTCCTCCCACCCACCAGG - Intergenic
1103698540 12:122835640-122835662 CCGCCCGCCGCCCGCTCGCCTGG - Exonic
1103800484 12:123534119-123534141 CCGGCCGCCCCTCCCCCGCCCGG + Intergenic
1103916160 12:124376693-124376715 CCAGGCTCCTCCAGCCCGCAGGG - Intronic
1103934119 12:124466321-124466343 CAGCCCTCCTTCCGCCCGCTGGG - Intronic
1103946228 12:124528181-124528203 CCCGCCTCCTCCCTCCAGCTGGG + Intronic
1104697310 12:130872639-130872661 TCGGCCGCCTCCCGCCCCGCAGG - Intronic
1105451273 13:20502355-20502377 CAGGTCTCCTCCCTCCGGCCGGG + Intronic
1105884060 13:24627328-24627350 CCGGCCTCCTCCCCTCTTCCAGG - Intergenic
1106539098 13:30674226-30674248 CCCGCCCCCTCCCGCGCGCCGGG - Intergenic
1107049108 13:36028511-36028533 CTTGCTTCCTCCCGCCCTCCAGG + Intronic
1107086620 13:36432572-36432594 GCGGCCTCCTCCCACCAGACAGG - Exonic
1108577775 13:51804157-51804179 CCGCCCTGGTCCCGCCCCCCGGG + Intronic
1112494753 13:99895996-99896018 CCGCGCTCCTCCTGCCCGCGGGG - Exonic
1113472633 13:110557798-110557820 CCCCCCGCCTCCCGGCCGCCAGG + Intronic
1113492953 13:110706314-110706336 CCGCCCTCCTCCCTCCACCCCGG - Intronic
1113504048 13:110800823-110800845 CAGCCCTCCTCCCACCTGCCAGG + Intergenic
1113790244 13:113024640-113024662 CCGTCCTGCCCCCGCCCACCTGG - Exonic
1113995160 14:16058228-16058250 CTGCCCACCCCCCGCCCGCCCGG + Intergenic
1114483184 14:23047884-23047906 CTGGGCTGCTGCCGCCCGCCTGG + Exonic
1114491666 14:23106200-23106222 CCGGCCTCCCCCGGCCTGCCTGG + Intergenic
1114493651 14:23118547-23118569 CAGCCCTCCTCCCTCCTGCCCGG - Intronic
1115985759 14:39102814-39102836 CCGGCCTCCTCCAGCTCCCCTGG - Intronic
1117315776 14:54569001-54569023 CCAGCCTCCTCCTACCCTCCAGG - Intronic
1117875958 14:60249823-60249845 CCGGCCTCCTCCCCCGAGCCGGG + Intronic
1118762639 14:68890105-68890127 CCAGCCTCCTGCCTCCCCCCAGG - Intronic
1119494744 14:75069266-75069288 CCGGCGTCCGCCCGCCTGGCGGG - Exonic
1119918849 14:78427344-78427366 CCTCCCTCCTCCCACCCTCCAGG - Intronic
1119998615 14:79279154-79279176 CCGCCCTCCTCTCGCTCGCGCGG - Intronic
1122049016 14:99042685-99042707 CCACCCTCCTCCCCTCCGCCTGG - Intergenic
1122220945 14:100238942-100238964 CGCGCCTCCTCCCGCCCTCCGGG - Intronic
1122267632 14:100554082-100554104 CCGTCCTCCCCCAGCCCGGCAGG - Intronic
1122523435 14:102363063-102363085 CCCGCCTCCTCCGGCCCGGCGGG + Exonic
1122602292 14:102927917-102927939 CCTGCCTCCTCCTGCACCCCTGG + Intronic
1122620748 14:103056666-103056688 CCCACCCCCTCCCCCCCGCCGGG - Intronic
1122689008 14:103522765-103522787 CCCGCCCCCGCCCGGCCGCCCGG - Exonic
1122880771 14:104689601-104689623 CCGCCCGCCCCGCGCCCGCCAGG + Intronic
1122894437 14:104749287-104749309 GCTGCCTCCTCGCTCCCGCCCGG + Intergenic
1122931176 14:104933637-104933659 CAGGTCCCCTCCCGCCCTCCCGG - Exonic
1122931213 14:104933740-104933762 CGGGTCGCCTCCCGCCCTCCCGG - Exonic
1122931255 14:104933843-104933865 CGGGTCGCCTCCCGCCCTCCCGG - Exonic
1122931286 14:104933910-104933932 CAGGTCCCCTCCCGCCCTCCCGG - Exonic
1123004448 14:105314675-105314697 CCGGCCGCCCCGCGCGCGCCCGG - Exonic
1123474914 15:20582558-20582580 CCAGGCCCCTCCAGCCCGCCTGG - Intergenic
1123643097 15:22417799-22417821 CCAGGCCCCTCCAGCCCGCCTGG + Intergenic
1125641000 15:41230810-41230832 CCGTCCTCCTCCCGGCCGCAGGG - Intergenic
1125814786 15:42575380-42575402 CTGGCATCCTCCCGCCCACCAGG + Intergenic
1125930172 15:43594377-43594399 CCCGCCTCCTCCCGCGCCTCAGG - Intronic
1125943340 15:43694209-43694231 CCCGCCTCCTCCCGCGCCTCAGG - Intronic
1128301159 15:66567157-66567179 CTGGCCGCCTCCCGCCTCCCAGG - Intergenic
1128982354 15:72197151-72197173 CCGGCCCCAGCCCGCCCGACCGG + Intronic
1129359018 15:75012831-75012853 CCTGCCTCCTCCAGCCACCCTGG - Intronic
1129424555 15:75454472-75454494 CCGGCGTCGCCCCGCCCGGCCGG + Intronic
1130089200 15:80805315-80805337 CCTGCCCCTTCCTGCCCGCCCGG + Intronic
1130317635 15:82809962-82809984 CCGGCCTGCTCTCGGCCGCGGGG + Exonic
1130512450 15:84600910-84600932 CCTCCCTCCTGCCGCCCGGCTGG + Intergenic
1130520565 15:84658126-84658148 CCGAGCGCCCCCCGCCCGCCGGG + Exonic
1131507128 15:93029014-93029036 CCTGCCTCCTCCCTCCTCCCTGG + Intergenic
1132551650 16:556215-556237 CAGGCCCTCTCCCGCCTGCCCGG + Intergenic
1132812424 16:1807747-1807769 CCTGCCTCCTCACACACGCCTGG + Exonic
1132947084 16:2537805-2537827 TCGGGCCTCTCCCGCCCGCCAGG + Intergenic
1132968608 16:2673598-2673620 CCGGGCCTCTCCCGCCCGCCAGG - Intergenic
1133072287 16:3254503-3254525 CGGGGCTTCTCCCGCCCGGCAGG + Exonic
1133188345 16:4116031-4116053 CCGGCCGCCCCCCGCGCTCCGGG + Exonic
1133784342 16:8963335-8963357 CTCGCCGCCGCCCGCCCGCCGGG - Exonic
1134062876 16:11209668-11209690 CCGGCCACCTCCTGCCAGCCCGG + Intergenic
1135429859 16:22374193-22374215 CAGGCCGCCGCCCGCCCGCGGGG + Intronic
1136268920 16:29137115-29137137 CCGGCCTCCTCCAGCTCCCAGGG - Intergenic
1136390633 16:29962109-29962131 CCGGCCTCCGCCCGGCCCCGAGG + Intronic
1136402278 16:30025194-30025216 CCGGCCGCCCCCGGCCTGCCAGG - Exonic
1137288861 16:47038002-47038024 CCCTCCTCCTCCCGCCCCGCGGG - Intergenic
1137621011 16:49876644-49876666 CCTGCCCCCTCCCGCCCCCTGGG - Intergenic
1138450777 16:57092574-57092596 GCCGCCGCCGCCCGCCCGCCCGG + Exonic
1138699937 16:58851959-58851981 CCGGCATCCTGCCACCCACCTGG + Intergenic
1140209248 16:72958179-72958201 CTGGGCTCCTCCCGCTCGCTGGG - Exonic
1140237432 16:73172076-73172098 CCCTCCTCCACCCGCCTGCCGGG + Intergenic
1140237483 16:73172305-73172327 CCTCCTTCCTCCTGCCCGCCAGG + Intergenic
1141461449 16:84180692-84180714 CTGTCCTCCACCCGCCCTCCCGG - Intronic
1141656937 16:85421571-85421593 CCTGCCTTCTCCTCCCCGCCTGG - Intergenic
1142049928 16:87951596-87951618 CCCTCCTCCTCCCGCCCGCCGGG + Intronic
1142163315 16:88570578-88570600 CCGGCCTCCCGCCGCCCTCCCGG - Intronic
1142260720 16:89041342-89041364 CCGGCCTCCTCCCGTCCCTCAGG - Intergenic
1142293251 16:89202065-89202087 CCGACCTCGCCCCGCCCGCGCGG - Intergenic
1142299443 16:89247795-89247817 CCGACCTCGCCCCGCCCGCGCGG - Intergenic
1142465333 17:133955-133977 CGCGCCTCCCCCCGCCCCCCAGG - Intergenic
1142601694 17:1056170-1056192 CCGTCTGCCTCCCGCCGGCCTGG - Intronic
1142876080 17:2852984-2853006 CCGCCCTCCCCGCGCCCACCCGG - Intronic
1143078555 17:4365694-4365716 CCGGCACCCTCGCGCCCGCGTGG + Intronic
1143091210 17:4450055-4450077 CCGGCCTCCTCCCTGCCTCCAGG + Intronic
1143181640 17:4987441-4987463 CCGTCCTCCTCCCCCGCGCCAGG - Intronic
1143621139 17:8080811-8080833 CCTGCCTCCTCCCCGCCCCCTGG - Exonic
1143765661 17:9135985-9136007 CCATCCTCCTCACTCCCGCCTGG + Intronic
1143822640 17:9577036-9577058 CCGTACTCATCCGGCCCGCCTGG - Intronic
1144339975 17:14302692-14302714 CCGCGCGCCGCCCGCCCGCCAGG - Intronic
1144519813 17:15945907-15945929 CCGGGCTCCACCCGCCCACGGGG - Intronic
1144762956 17:17717658-17717680 CCAGCCTCCTGCCCCCCACCTGG + Intronic
1146356990 17:32142652-32142674 CCGGCCTCCGCCCGCACGCACGG - Exonic
1146654273 17:34626144-34626166 CCGGCCAGCCCCAGCCCGCCGGG + Exonic
1146935113 17:36808370-36808392 CCGGCCTCCTATCTCCCGCCCGG - Intergenic
1147324554 17:39663985-39664007 CCTTCCTCCTCCCTCCCGGCTGG + Intergenic
1147378029 17:40034524-40034546 CTGGCATCTTCCCTCCCGCCAGG + Intronic
1147742530 17:42677037-42677059 CCGGCCCCCTCCCTCCCGGGGGG + Intergenic
1147996743 17:44363750-44363772 CCCGCCTGGTCCCGCTCGCCCGG + Exonic
1148440420 17:47709029-47709051 CCAGCGTCCTCTCGCCCGGCGGG - Exonic
1148835470 17:50463632-50463654 GCTGCCTCCTCCCTCCAGCCAGG + Intronic
1149512754 17:57256617-57256639 CCCTCCTCCTCCCCCCCGCCCGG - Exonic
1149998459 17:61417111-61417133 TCGCCCTCCTGCCGCCAGCCAGG + Intergenic
1151612159 17:75183117-75183139 CGCGCCTCTTCCCGCCGGCCGGG - Intergenic
1152111569 17:78360002-78360024 CCAGCCGCCAGCCGCCCGCCCGG - Exonic
1152198264 17:78930110-78930132 GCAGCATCCTCCCGCCAGCCCGG - Intergenic
1152214380 17:79024043-79024065 GCCGCCTCCTCCCGGCCCCCTGG - Intronic
1152354700 17:79801102-79801124 CCAGCCTCCACCCTCCCTCCCGG - Intronic
1152675250 17:81636880-81636902 CCGGCGTCCCCGCTCCCGCCCGG + Intronic
1152708860 17:81860292-81860314 CCGAGCCCCGCCCGCCCGCCAGG + Intronic
1152721330 17:81925147-81925169 CCGCCCTCCTCCAGCCCTCAAGG + Intronic
1156213780 18:34976724-34976746 CCGGCCTCCTCCCTCTCGAGCGG + Intergenic
1156452712 18:37275518-37275540 TCGGCCTCCTCCCGCCTGCAGGG + Intronic
1156465675 18:37346778-37346800 CAGGCTTCCTCCCTCCTGCCAGG - Intronic
1156536751 18:37871789-37871811 CCAGCCTCCTCCAGCCCCACTGG - Intergenic
1156713453 18:39976959-39976981 CCGGCGTTCTCCCTCCCGCGAGG - Intergenic
1157095197 18:44680542-44680564 CCGGTCTCCCCCTTCCCGCCGGG - Intronic
1157581615 18:48777151-48777173 CCGGCTCCTTCCCACCCGCCTGG + Intronic
1157716143 18:49888712-49888734 CCAGCCTCTTCCCGCCCTCCAGG + Intronic
1158679552 18:59554782-59554804 CCAGCCTCCTCCAGCCAGACAGG + Intronic
1160025543 18:75212156-75212178 CCGGCCTCCCCCGGCCATCCGGG - Intronic
1160698110 19:494364-494386 CAGGCCTGCTGCCCCCCGCCCGG + Intronic
1160724187 19:610418-610440 GAGGCTGCCTCCCGCCCGCCCGG - Intronic
1160768708 19:821165-821187 CCGGCCTCCCCGCCCCCTCCAGG + Intronic
1160873158 19:1286065-1286087 CCGCCCTCCGCCCGCCCGCTCGG + Intergenic
1160967839 19:1754335-1754357 CTGGCCGCCTACGGCCCGCCAGG + Exonic
1161043357 19:2121700-2121722 CTGTCCGCCGCCCGCCCGCCTGG - Intronic
1161249008 19:3270612-3270634 CGTGCCGCCGCCCGCCCGCCCGG - Intronic
1161320218 19:3637628-3637650 CCTTCCTCCTCCGGCCCACCCGG - Intronic
1161321621 19:3644134-3644156 TGGGCCTCCTCCCGCTCGCTAGG + Exonic
1161356479 19:3822010-3822032 CAGGCCTCCCAGCGCCCGCCGGG + Intronic
1161400763 19:4065623-4065645 CCGCCCGCCTCCCCCACGCCCGG + Intronic
1161409460 19:4108809-4108831 CCCTCCTCCTCGCGCCCGGCAGG - Intronic
1161435062 19:4258220-4258242 CCCGCCGCCCCGCGCCCGCCAGG + Exonic
1161779286 19:6280144-6280166 CCTCCCTCCTCCCGCCCCTCCGG - Intergenic
1161957713 19:7505889-7505911 CCCACCTCCTCCCTCCCCCCCGG + Intronic
1162359578 19:10210460-10210482 CCAGCCTCCTTCTGCCTGCCAGG + Intronic
1162393843 19:10404988-10405010 CCCGTCCCCTCCCGCCCCCCAGG + Intronic
1162426869 19:10602414-10602436 CCGGCCCCGCCCCTCCCGCCGGG - Intergenic
1162778710 19:12995805-12995827 CCGGCCGCCGCGCTCCCGCCCGG + Exonic
1162802366 19:13118482-13118504 CCGGCCTCCTCCAGCCGGGGCGG + Intronic
1163012267 19:14433501-14433523 ATGTCCTCCTGCCGCCCGCCAGG - Intronic
1163118253 19:15200751-15200773 CCGCCCTCGTCCCATCCGCCAGG + Intronic
1163243123 19:16076427-16076449 CCCGCCTCTCCCCGCCCCCCGGG - Intronic
1163321150 19:16575886-16575908 CCCGCCCCCTCCCTCCCGCCTGG + Exonic
1163521594 19:17795087-17795109 CCCGCTTCCTCCCTCCCACCGGG - Intronic
1164782468 19:30904206-30904228 CCGGCCTCCTCCTGTCCCTCAGG + Intergenic
1165065379 19:33225519-33225541 CCGCCCGGCGCCCGCCCGCCTGG + Intronic
1165851354 19:38851944-38851966 CCGGCCTCCTCCCGTCACGCGGG - Intronic
1166133967 19:40764096-40764118 CCGGCCTCCACCCTGACGCCAGG - Intronic
1166306844 19:41940231-41940253 CCGGGCTCCCCGCGCCCGCCAGG - Intergenic
1166347791 19:42177106-42177128 CTGCCCGCCGCCCGCCCGCCCGG + Intronic
1166766447 19:45254205-45254227 CTGGCTCCCTCCCGCCCGGCTGG - Intronic
1167234144 19:48303616-48303638 CGGGCCTCCTCCCTCCACCCAGG + Intronic
1167471454 19:49678161-49678183 CCCTCCTCCCTCCGCCCGCCAGG - Intronic
1167620218 19:50556351-50556373 CCAGGCTCCTCCCACCCACCAGG + Intronic
1167638219 19:50667300-50667322 CCTGCCGCCTCCCGCCCCCTCGG - Exonic
1167643834 19:50695403-50695425 CCGGCCCCCTCCCCCCTGCCCGG - Intronic
1168287081 19:55340383-55340405 CCGACCTCCTCTCACCCTCCAGG + Intronic
1168293826 19:55369523-55369545 CCGGGCTTCTGCCGCCCACCCGG - Intronic
1168408265 19:56121609-56121631 CCGGGCTCCTCGCGCCTGCGCGG + Intergenic
1168528402 19:57106552-57106574 CCTGCATCCTCCCTCCTGCCTGG + Intergenic
924962497 2:46680-46702 CCCGCCTCCTCACTCCCGCCCGG + Intronic
924991104 2:314047-314069 CCTGCCCCCTCCCACCCTCCTGG - Intergenic
925114888 2:1370075-1370097 CAGGCCTTCTGCCGCCCGCCCGG + Intergenic
926168296 2:10535160-10535182 CTGCCCTCCTCCCAGCCGCCTGG + Intergenic
927501851 2:23588409-23588431 CAGGCCTCCCCTTGCCCGCCTGG + Intronic
927964789 2:27262280-27262302 CCGGCGGCCGCCCGCCCCCCAGG + Intronic
929188709 2:39120741-39120763 GCGGCCGCCGCCCGCCCGCCGGG + Intronic
929437739 2:41940980-41941002 CCGGCCTCCTCCCCCTCCTCTGG - Intronic
929552932 2:42905792-42905814 CCGTCCTCCACCCGCCGTCCGGG - Intergenic
930780751 2:55223469-55223491 CAGGGCACCTCCCGCTCGCCGGG + Intronic
931309561 2:61065758-61065780 CCGGTGCCCTCCCGCCCGGCAGG + Intergenic
931355846 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG + Intronic
932043095 2:68319969-68319991 TCAGCCTCCTCCCGCCTGGCTGG - Exonic
934113938 2:88766214-88766236 CAGGCCTCCTCCCGCAGCCCCGG - Intergenic
934538959 2:95159228-95159250 CCGGCCTCCTACCCCCGGCTCGG + Exonic
934636090 2:95991472-95991494 CAGGCCTCCTCCCGCAGCCCCGG + Intronic
934797556 2:97113954-97113976 CAGGCCTCCTCCCGCAGCCCCGG - Intronic
934835856 2:97589485-97589507 CAGGCCTCCTCCCGCAGCCCCGG + Intronic
935046611 2:99489458-99489480 CCGGCCGCATCCCGCCGGCCCGG - Intronic
935218201 2:100990883-100990905 CTTGCCTCCTGCCTCCCGCCAGG - Intronic
936561297 2:113541827-113541849 GCGCCCTGCACCCGCCCGCCTGG - Intergenic
937283634 2:120736600-120736622 CCGGCCTCCGCGCGCCGGCGGGG + Intronic
938257320 2:129869335-129869357 CTGGCATCCTCCCGCTGGCCGGG + Intergenic
938909832 2:135876085-135876107 CCAGGCTCCTCGCGGCCGCCGGG + Intronic
940009419 2:149038645-149038667 CCGGCCCCCTCCCGCGCCCCAGG + Exonic
942268247 2:174248693-174248715 CCGCCCTACTCCCGCCTCCCCGG - Exonic
942653744 2:178194382-178194404 CCGGCTCCCGCCCGTCCGCCCGG - Intergenic
946326050 2:218985215-218985237 CCGGGCTGCCCCCTCCCGCCAGG - Exonic
946371907 2:219286115-219286137 CCGGCCCCCACCCGCCACCCAGG - Exonic
947533389 2:230926480-230926502 CTGGCCTCCTCCCGCACCCAGGG - Intronic
947765199 2:232633473-232633495 GCGGCCTCCTCCCACCAGGCTGG + Exonic
947801082 2:232928665-232928687 CCGGCCCCCTCCCCACCGCGAGG - Intronic
948201594 2:236133415-236133437 CCAGCCTCCTCCCGGCCGTCTGG + Intergenic
948678281 2:239611883-239611905 CCGGCCTCCTTCTGCCCACCAGG - Intergenic
948948669 2:241235102-241235124 CCGGCCACCTCCTGCTCACCCGG + Exonic
949022694 2:241750374-241750396 CCGGGCACCCCCCGCCCACCCGG - Intronic
1169116759 20:3071396-3071418 CCGGCCTGCTCCCTTCCGCAAGG + Intergenic
1171011613 20:21512368-21512390 CCGGCGTCCCCCCCGCCGCCCGG + Exonic
1171810133 20:29740893-29740915 CCGCCCGCCCCCCGCCTGCCGGG - Intergenic
1172101282 20:32484796-32484818 CCTGCCTCCTCCTGCGCCCCGGG - Intronic
1172252538 20:33490039-33490061 CTGGCCCCGCCCCGCCCGCCGGG - Intergenic
1173279837 20:41618250-41618272 CCGGCCCCGCCCCGCCGGCCGGG - Intronic
1173860690 20:46281327-46281349 CTGGCCTCCTCCAGTCCCCCAGG - Intronic
1174583017 20:51586092-51586114 CTGGGCTCCTCCCGTCCCCCGGG + Intergenic
1175074049 20:56358949-56358971 CCGGCCTCCGCCCGCCTCCCGGG + Exonic
1175136372 20:56827404-56827426 GCCGCCTGCCCCCGCCCGCCCGG + Intergenic
1175439632 20:58981529-58981551 CCGCCCCGCCCCCGCCCGCCCGG + Intronic
1175752650 20:61509662-61509684 CCTGACTTCTCCCGCCTGCCTGG - Intronic
1177730764 21:25024785-25024807 CCAGCCTCCTCCCGCTTGCAGGG - Intergenic
1180014684 21:45074528-45074550 CCCGCCCCCGCCGGCCCGCCGGG - Intronic
1180311932 22:11249181-11249203 CTGCCCACCCCCCGCCCGCCCGG - Intergenic
1180650074 22:17369918-17369940 CGCGCCGCCTCCCGCCCGCGCGG - Intronic
1180791543 22:18577869-18577891 CCGTCCGCCTGCCGCCAGCCCGG + Intergenic
1181065420 22:20303455-20303477 CCGACCTCCTCCTCCCCACCAGG - Intergenic
1181230197 22:21417442-21417464 CCGTCCGCCTGCCGCCAGCCCGG - Intronic
1181248452 22:21517421-21517443 CCGTCCGCCTGCCGCCAGCCCGG + Intergenic
1181307110 22:21923145-21923167 CCTGCCTCCTCCCTTCTGCCTGG + Exonic
1181499326 22:23306846-23306868 CCGCCCGGCTCCGGCCCGCCCGG - Intronic
1181585205 22:23849358-23849380 CCGGCCTCGGCCCGCCTGCGTGG - Intergenic
1183364858 22:37401520-37401542 GCGGCCTCCTCCCTCCCTGCTGG - Intronic
1183393790 22:37560551-37560573 CCGCCCTCGTCCCGCGCCCCCGG + Exonic
1183605946 22:38866721-38866743 CAAGCCTCCGCCCGCCCCCCTGG - Exonic
1183607115 22:38872278-38872300 CCGCCGCGCTCCCGCCCGCCGGG - Exonic
1184046779 22:41976925-41976947 GCGCTCTCCTCCCACCCGCCCGG - Exonic
1184352841 22:43955720-43955742 TCGGCCTCCTCCACCCAGCCCGG - Intronic
1184572745 22:45336829-45336851 CCAGCCTCCTCCAGCCCCCAAGG + Intronic
1185147588 22:49147679-49147701 CCAGCCTCCTCCCCACTGCCAGG - Intergenic
1185148160 22:49150331-49150353 CCGGCCTCCTGCAGCTGGCCTGG - Intergenic
1185196164 22:49470760-49470782 TCGGCCTCCACCATCCCGCCAGG - Intronic
1185234566 22:49704596-49704618 CCCGCCTCCTCCCGCCAGACCGG + Intergenic
1185259338 22:49853268-49853290 CCGCCCTCCTCCCGCCGACCCGG + Intergenic
1185295242 22:50049850-50049872 CAGGCCTCCTCCTGCCCGGGCGG - Intronic
951264720 3:20552486-20552508 CCGGCCTCCTCAGGCCCTCCTGG + Intergenic
951898352 3:27632780-27632802 CCCGCCTCTCCCCGCCCCCCGGG - Intergenic
953549894 3:43894036-43894058 CCCGCCCCCCCCCGCCCCCCTGG - Intergenic
954125487 3:48525518-48525540 CCAGCCACCTACTGCCCGCCTGG - Intronic
954415043 3:50389154-50389176 CCGGCCTCCGCCCCCGCCCCAGG - Intronic
954539500 3:51384464-51384486 CCAGCCTCCTCCTGCCTCCCCGG - Intergenic
955972036 3:64445577-64445599 CCGGCATCCCCCCGCCCTCCCGG + Intergenic
956677965 3:71753516-71753538 CCGGCCGCCTCCCGACCCCGCGG + Intronic
956813577 3:72888118-72888140 GCCTCCTCCGCCCGCCCGCCGGG - Exonic
959085713 3:101849324-101849346 CCGCCCTCGCCCCGCCCGCCCGG - Intronic
961045192 3:123703304-123703326 CAGCCCTCCTCCCGCCTGCTGGG + Intronic
961349615 3:126291588-126291610 CCGGCCTCCTTCCCTCCTCCAGG - Intergenic
961829811 3:129617694-129617716 AGTGCCTCCTCCTGCCCGCCAGG - Intergenic
963335599 3:143971403-143971425 CCGGCCTCGCCCCACCCCCCAGG + Intergenic
966883283 3:184361657-184361679 CCGCCCTCGGCCCGCCCGCCGGG - Intronic
967858211 3:194134145-194134167 CCGCCTCCCTCCCGCCTGCCCGG - Intergenic
967880371 3:194297284-194297306 CCGGACCGCTCCCGCCTGCCAGG + Intergenic
968035317 3:195543404-195543426 CCCGCCCCCTCCGTCCCGCCCGG + Intergenic
968199544 3:196740227-196740249 CCGGGCCGCTCCCGCCCGCCAGG - Intronic
968230882 3:197003791-197003813 CGGGCCTCCACCCGCCTCCCCGG + Intronic
968914648 4:3492155-3492177 CAGGCTGCCTCCCGCCTGCCAGG - Intronic
969376635 4:6767757-6767779 CTGTCCCCCTGCCGCCCGCCCGG + Intergenic
969483297 4:7458195-7458217 CCCGCCTCCCCCCGCCCCACAGG - Intronic
969570448 4:8005161-8005183 CCCGCCGCCGCCTGCCCGCCGGG - Intronic
970188074 4:13484000-13484022 CCGGCCTCCTCCCCGCCGCCCGG - Intronic
971451362 4:26804657-26804679 CGCGGCTGCTCCCGCCCGCCGGG - Intergenic
972533052 4:39977571-39977593 GCCGCCGCCGCCCGCCCGCCCGG + Exonic
973293188 4:48490222-48490244 CCCGCCTCCGCTCGGCCGCCCGG + Intergenic
977257604 4:94758116-94758138 TCGGCCGCCTCCCGCGCGCTCGG - Intronic
978384488 4:108166983-108167005 CCGGCCTGCTCCCCGCGGCCCGG + Intronic
978503688 4:109434220-109434242 CCGGCCCCCGCCCCCACGCCAGG - Intronic
980930350 4:139177695-139177717 CCGGCTTTCCCCCGCCGGCCGGG + Intergenic
985005926 4:185535436-185535458 CCGCCTTCCTCCCGCCCACCGGG + Exonic
985670993 5:1206640-1206662 CCATCATCCTCCCGCCCCCCAGG - Intronic
985859851 5:2462285-2462307 CTGGCCTCCTCCCTTCCCCCAGG + Intergenic
989061564 5:37415667-37415689 CCCCCCACCTCCCTCCCGCCGGG + Intronic
991216940 5:64166110-64166132 CTGGCCGCCTCTCGCCCGGCGGG + Intronic
994366996 5:98928422-98928444 CCGGCCTTCACCCGGCCGCTGGG + Intronic
997521643 5:134527259-134527281 CCGCCCGCCTCCTCCCCGCCTGG + Intronic
998200374 5:140113888-140113910 CCCCCGTCCGCCCGCCCGCCAGG - Intronic
999300349 5:150486532-150486554 GCCGACTCCACCCGCCCGCCCGG - Intronic
1001484583 5:172110645-172110667 CCGGCCCCCTCCTTCCGGCCAGG - Intronic
1002298082 5:178242223-178242245 CCTGCCTCCGCCCACCTGCCCGG + Intronic
1002527341 5:179821847-179821869 TTGGCCACCTCCCGCCCTCCTGG - Intronic
1002800167 6:514825-514847 CCGCCCTCCTCCCCTCCTCCTGG - Intronic
1003256828 6:4482496-4482518 CCTGCCTCCTTGCTCCCGCCTGG - Intergenic
1003869405 6:10390301-10390323 CCAGCCTCCCCGCCCCCGCCGGG + Intergenic
1003871290 6:10404930-10404952 AGGGCCGCCTCCCGGCCGCCGGG - Intronic
1004747240 6:18523102-18523124 CAGGCATCCGCCCGCACGCCCGG - Intergenic
1004923862 6:20401524-20401546 CCTGTCCCCGCCCGCCCGCCGGG - Intergenic
1005322239 6:24666823-24666845 CCGCCTCCCTCCCGCCCTCCAGG + Exonic
1006517232 6:34551814-34551836 CCCGCCTCCTCCAGCCAGCAGGG + Intronic
1007110914 6:39313227-39313249 CCGGCCTCCTCCGCCCTGCTAGG + Intronic
1007697056 6:43740627-43740649 CCGGCCTCCCCTCCCCCACCAGG + Intergenic
1013514754 6:110875442-110875464 CCGGCCTCCTCCCCTCCCCCAGG - Intronic
1014632461 6:123803655-123803677 CCGCCCCACCCCCGCCCGCCGGG + Intergenic
1015440588 6:133241910-133241932 CCGGCCTCCAAGCGCCCCCCGGG - Intronic
1015507824 6:134007415-134007437 CCGGCTTCCTCATGCCCACCTGG - Intronic
1015842402 6:137489193-137489215 CAGGCCACCTCCCTCCCGCACGG + Intergenic
1017532960 6:155314728-155314750 CCCGCCTCGTCCCGCCCTCCTGG - Intergenic
1019111945 6:169724050-169724072 GCCCCCTCCGCCCGCCCGCCCGG + Exonic
1019127545 6:169850940-169850962 CCGGCCTCCTCCCCATTGCCAGG - Intergenic
1019279518 7:192907-192929 CCAGCCGCCCCCCGCGCGCCCGG + Intergenic
1019314422 7:377849-377871 CCTGCCCCTTCCTGCCCGCCAGG + Intergenic
1019321379 7:416977-416999 CCTGCCTCTTCCCACCCCCCCGG - Intergenic
1019343291 7:518431-518453 CCGGCGCAGTCCCGCCCGCCCGG - Intronic
1019708848 7:2509347-2509369 CCGGCCTCCTCCGGGCCGTTTGG - Intergenic
1019899214 7:4006895-4006917 TCGGCCCCATCCCGCCAGCCTGG - Intronic
1020055887 7:5117386-5117408 CCGGCTTCCTCCTGCCCTCCAGG + Intergenic
1020080345 7:5283161-5283183 CCCGCCCCCTCCCGCCCGCCCGG + Intronic
1020080594 7:5283868-5283890 CCGCGCTCCTCCGGCCAGCCAGG - Intronic
1020092352 7:5348765-5348787 CCTGCCTGCCCCCGCCTGCCTGG - Intronic
1020224970 7:6272633-6272655 CGGGCCTCCTCCCGCCGGGCGGG + Exonic
1020278439 7:6637878-6637900 CCGAGCGCCTCCCGCCCCCCAGG - Exonic
1022097109 7:27147972-27147994 CCGCCCGCCCGCCGCCCGCCCGG + Intronic
1023638754 7:42237821-42237843 CCCCGCTTCTCCCGCCCGCCGGG + Intronic
1023871111 7:44263490-44263512 CCCTCCTCCTCCTGCCAGCCGGG - Intronic
1024224501 7:47315312-47315334 CCGGCCACCTCACCCCCGCAGGG - Intronic
1025198330 7:56948312-56948334 CCGCGCTCCTCCGGCCAGCCAGG + Intergenic
1025210338 7:57016656-57016678 CCGCCCTCCGCCACCCCGCCTGG - Intergenic
1025661617 7:63560191-63560213 CCGCCCTCCGCCACCCCGCCTGG + Intergenic
1025673619 7:63628621-63628643 CCGCGCTCCTCCGGCCAGCCAGG - Intergenic
1026866632 7:73828087-73828109 CCGCCCGCCTCCTGCCCCCCCGG - Intronic
1026969800 7:74461013-74461035 ACGTCCACCTTCCGCCCGCCTGG + Intronic
1027111307 7:75442248-75442270 CCGCCGCCCACCCGCCCGCCCGG - Intronic
1027283549 7:76626811-76626833 CTGGCCGCCGCCCGCCCGCCCGG - Exonic
1027374632 7:77537492-77537514 CCCCCCGCCGCCCGCCCGCCCGG - Exonic
1028984890 7:97002087-97002109 CCCTCCTCCTCCCACCCGCAAGG + Intergenic
1030049042 7:105522021-105522043 GCGGCCTCCCCGCGGCCGCCGGG - Intronic
1032274264 7:130440818-130440840 CCGGCCCCTTCCCGCCTTCCGGG + Intronic
1034306450 7:150048345-150048367 CCGGCCTCCTCCCCGCGCCCGGG + Intergenic
1034439974 7:151081430-151081452 CCTGCCTCTTCCCGCCGCCCTGG - Exonic
1034456750 7:151174779-151174801 CCTGCCGCCTCGCGCCCTCCAGG + Intergenic
1034470449 7:151251879-151251901 CCGGCCGCCGCCCGCTCGCTCGG - Intronic
1034508924 7:151519219-151519241 CCGGCCGCCACCTGCCCGCCCGG + Intronic
1034800396 7:154052297-154052319 CCGGCCTCCTCCCCGCGCCCGGG - Intronic
1035105876 7:156441142-156441164 CTGGCCTCCTTCCGCCAGCTCGG + Intergenic
1035212345 7:157337374-157337396 CCGGCCGCGTCCTCCCCGCCCGG + Intronic
1035283326 7:157791479-157791501 CCCGCCTCCACACGCCTGCCTGG + Intronic
1035283868 7:157794066-157794088 GCGGCCCCCTCCCGGCCACCTGG - Intronic
1035761636 8:2072992-2073014 CCGGCTTCCCCCCGCCCGTGGGG - Intronic
1036510367 8:9394432-9394454 CCTGCCTCCACCCGACCCCCAGG + Intergenic
1038205011 8:25458023-25458045 GCGGCCTCCTCCCGACCCTCAGG - Intronic
1038540206 8:28385453-28385475 CCCGCCTCCGCCCGCGCCCCTGG - Intronic
1040981767 8:53251759-53251781 CCTGCCCCGCCCCGCCCGCCCGG + Intergenic
1042903006 8:73746898-73746920 CCCGCCTCCGCCCGCCTCCCCGG + Exonic
1045098759 8:98825411-98825433 CGAGCCTCTCCCCGCCCGCCGGG - Intronic
1047739399 8:127794578-127794600 CCGGCCGCCCCGAGCCCGCCCGG - Intergenic
1047961772 8:130016378-130016400 CCGCGCTCCCCTCGCCCGCCCGG - Intronic
1049262246 8:141646012-141646034 CCGGCCACCTCCCGCCTCCGAGG + Intergenic
1049310964 8:141933667-141933689 CCTGCCTTCTCCGGCCCACCTGG + Intergenic
1049788547 8:144462664-144462686 CCGGCATCCGCCCGCCGGGCCGG - Intronic
1049891391 9:73512-73534 GCGCCCTGCACCCGCCCGCCCGG + Intergenic
1051619429 9:19036098-19036120 CCAGCCCCCTACCCCCCGCCAGG - Intronic
1052862982 9:33447954-33447976 CAGGTCTCCTCCTGCCCGCAAGG - Intergenic
1053732819 9:41074586-41074608 GCGCCCTGCGCCCGCCCGCCTGG + Intergenic
1054695609 9:68356969-68356991 GCGCCCTGCACCCGCCCGCCTGG - Exonic
1055514364 9:77020958-77020980 CTGGTCTCCCCACGCCCGCCGGG - Intergenic
1055530309 9:77177351-77177373 CCCGCCTCCTCCCCATCGCCTGG - Intronic
1057259567 9:93576361-93576383 GCCGCCTCCGCCCGCCGGCCTGG - Intergenic
1057489567 9:95510870-95510892 CCGGACTCCCCGCGCCCGCGCGG + Intronic
1057761115 9:97875164-97875186 CAGGCCCCCTCCTGCCCACCTGG + Intergenic
1058357009 9:104094523-104094545 CCCGCCTCCCGCCTCCCGCCAGG - Intronic
1058843585 9:108934143-108934165 CCGGCCTCGCCCCCTCCGCCTGG - Intergenic
1058903201 9:109459821-109459843 TTGGCCTCCTCCCGCCTCCCTGG + Intronic
1059102353 9:111483389-111483411 GCGGCCGCCGCCCGCCCACCGGG + Intronic
1060812690 9:126618971-126618993 GCGGCGTCCTTCCGCCCGCAGGG + Intronic
1060849087 9:126860372-126860394 CCGCCCTTCTCCCGCCAGCAGGG + Intergenic
1061179003 9:129013126-129013148 CCTCCCTCCGCCCGACCGCCTGG - Intronic
1061232007 9:129320682-129320704 CCGGCCTCCTCCCTTCCCCATGG + Intergenic
1061234485 9:129334583-129334605 CCGGCTTCCTCCACCCCGGCTGG + Intergenic
1061262658 9:129488602-129488624 CCGGCCCCCTCCCGCCCTCGCGG + Intergenic
1061299639 9:129697338-129697360 CGTGCCCCCTCCCGCCCGGCCGG + Intronic
1061349628 9:130054090-130054112 TCGGCCTCCGCCCCCCGGCCCGG - Intronic
1061438210 9:130579839-130579861 CAGGCTGCCTCCCGCCCCCCAGG - Intronic
1061949887 9:133930293-133930315 CTGGCCTCCTCACTCCCTCCTGG + Intronic
1061949927 9:133930465-133930487 CCGGCCTCCTCTCTGCCTCCCGG + Intronic
1061961692 9:133992045-133992067 CCGGGGCCCTCCCGCCCGCCGGG + Intronic
1062087305 9:134655364-134655386 CCGCCCTCCACCCTCCCGGCTGG - Intronic
1062141181 9:134959956-134959978 CCGTCCTCCTCCTGCCTGCAGGG - Intergenic
1062427024 9:136510805-136510827 CCGGCCTCCTCCTGCCCCGCAGG - Exonic
1062534956 9:137017371-137017393 CCGTCATCCACCCGCACGCCCGG + Intronic
1062619234 9:137411966-137411988 CTTGCCGCCTCCCGCCCTCCTGG - Intronic
1187669802 X:21657048-21657070 CTGGCCTCGTGCTGCCCGCCCGG - Exonic
1189332611 X:40152896-40152918 CCTGTCTCCTCCCGCCCTCTCGG - Intronic
1190241246 X:48659448-48659470 CCGGCCACCTCCCTCCCGGATGG + Intergenic
1190345329 X:49332011-49332033 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190346424 X:49341576-49341598 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190347675 X:49532605-49532627 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190348776 X:49542161-49542183 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190349876 X:49551717-49551739 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190350981 X:49561270-49561292 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190352082 X:49570828-49570850 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190353183 X:49580377-49580399 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190355386 X:49599448-49599470 CCGCCCGCCTCGCCCCCGCCGGG - Intronic
1190483807 X:50904266-50904288 CCAGCCACCTCCCTCCAGCCTGG - Intergenic
1195625285 X:107000138-107000160 CCGGCCTCACCCCTCCCGCCCGG - Exonic
1197734880 X:129843373-129843395 CCGGCCTCCGGCCCCCCGCTGGG - Intronic
1199772592 X:150984025-150984047 CCTCTCGCCTCCCGCCCGCCCGG + Intronic
1200154534 X:153968440-153968462 TCTGCCCCCTCCCGCCAGCCCGG - Intronic