ID: 931355856

View in Genome Browser
Species Human (GRCh38)
Location 2:61537516-61537538
Sequence CCGCGCCGCCGCCCGACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 227}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931355839_931355856 18 Left 931355839 2:61537475-61537497 CCGCCGCCGCGCCCCACGCCGGC 0: 1
1: 0
2: 7
3: 104
4: 903
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355841_931355856 12 Left 931355841 2:61537481-61537503 CCGCGCCCCACGCCGGCCTCCTC 0: 1
1: 2
2: 7
3: 69
4: 762
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355835_931355856 28 Left 931355835 2:61537465-61537487 CCCGCGGCCGCCGCCGCCGCGCC 0: 1
1: 2
2: 68
3: 627
4: 1802
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355837_931355856 21 Left 931355837 2:61537472-61537494 CCGCCGCCGCCGCGCCCCACGCC 0: 1
1: 3
2: 35
3: 271
4: 3042
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355842_931355856 7 Left 931355842 2:61537486-61537508 CCCCACGCCGGCCTCCTCCCGCC 0: 1
1: 0
2: 5
3: 66
4: 657
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355848_931355856 -7 Left 931355848 2:61537500-61537522 CCTCCCGCCCGCCCGGCCGCGCC 0: 1
1: 5
2: 141
3: 3562
4: 5000
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355843_931355856 6 Left 931355843 2:61537487-61537509 CCCACGCCGGCCTCCTCCCGCCC 0: 1
1: 0
2: 6
3: 50
4: 552
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355847_931355856 -4 Left 931355847 2:61537497-61537519 CCTCCTCCCGCCCGCCCGGCCGC 0: 1
1: 5
2: 33
3: 247
4: 1494
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355845_931355856 0 Left 931355845 2:61537493-61537515 CCGGCCTCCTCCCGCCCGCCCGG 0: 1
1: 1
2: 14
3: 128
4: 946
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355840_931355856 15 Left 931355840 2:61537478-61537500 CCGCCGCGCCCCACGCCGGCCTC 0: 1
1: 0
2: 8
3: 83
4: 649
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355836_931355856 27 Left 931355836 2:61537466-61537488 CCGCGGCCGCCGCCGCCGCGCCC 0: 2
1: 19
2: 204
3: 2253
4: 4592
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355844_931355856 5 Left 931355844 2:61537488-61537510 CCACGCCGGCCTCCTCCCGCCCG 0: 1
1: 0
2: 11
3: 75
4: 672
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227
931355849_931355856 -10 Left 931355849 2:61537503-61537525 CCCGCCCGCCCGGCCGCGCCGCC 0: 1
1: 3
2: 39
3: 341
4: 4865
Right 931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG 0: 1
1: 0
2: 6
3: 19
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931355856 Original CRISPR CCGCGCCGCCGCCCGACCCT CGG Intronic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900135749 1:1116245-1116267 CCGCCCCGGCGCCCCACCCACGG - Intronic
900342230 1:2194659-2194681 CCGCGCCCCCGCCCGGCTCCCGG + Intronic
900460586 1:2800654-2800676 CACCGCCGCCCCCCGAGCCTGGG + Intronic
900633947 1:3652650-3652672 CCGAACCGCCCCCCGGCCCTGGG - Intronic
901434015 1:9235118-9235140 CCGCGCTGCCGCCGGGCCCGAGG + Intronic
901762280 1:11479032-11479054 CCGCGCTGCCGCCCAATCCCTGG - Intergenic
903078093 1:20787309-20787331 CCGCCCCGCCCCCCTACCCGCGG + Intronic
903263536 1:22143418-22143440 CCCGGCCGCCGCCCGGGCCTAGG + Intronic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
903935168 1:26890364-26890386 CGGCTGCGCCGCCCGCCCCTCGG - Intergenic
904701630 1:32361689-32361711 CCCCGCCTCCGCCCGTCCCGCGG - Intronic
905580958 1:39082197-39082219 CCGGGCTCCCGCCCGACCCTCGG - Intronic
905846900 1:41241626-41241648 TCGCGCCGCCGCCCGGCCCTCGG + Intronic
907069337 1:51519425-51519447 CCGCGGCGCCGCCCAAACCCTGG + Intergenic
907213516 1:52842981-52843003 CCGCGTCGCCGCCCGCACCCCGG - Intronic
908355945 1:63324516-63324538 CGAGGCCGCCGCCGGACCCTGGG - Exonic
909622515 1:77683579-77683601 CCTCGGCGGCGCCCGACCCGCGG - Intergenic
911618270 1:100038329-100038351 CCGCGCCGGCGAGCGTCCCTCGG + Intronic
912416226 1:109509742-109509764 CGTCGCCGCCGCCGGAGCCTCGG + Intergenic
912492620 1:110070472-110070494 CCGCGCCGCCCCGCGGCCCGCGG - Exonic
916483388 1:165235609-165235631 CCGCGCCGCCGCGCGTTCCCAGG - Intronic
917962275 1:180154731-180154753 CCGCCCCGCCGGCCGCTCCTGGG - Intergenic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
1062795815 10:344376-344398 CCCCGCCCCCGCCCCACCCTTGG - Intronic
1062843775 10:689664-689686 CCGCGCCGCCGCCTCCTCCTCGG - Exonic
1063429631 10:5977455-5977477 GCGCGCGGCTGCCGGACCCTCGG - Exonic
1064384586 10:14878969-14878991 CGGCCCCGCCGCCCGGGCCTTGG - Intronic
1064443105 10:15371058-15371080 CCGAGCCGCCGCCGGCCCCGCGG - Exonic
1067318945 10:45199109-45199131 CAGTGACGCCGTCCGACCCTAGG + Intergenic
1068762974 10:60733233-60733255 CCGCGCCGCCCCCCTACCTGCGG - Intronic
1071573833 10:86711819-86711841 CCTGGCCGCCGCCCGGCCCGCGG - Intronic
1072719477 10:97771858-97771880 CCGCGCAGCCCCCCGACGCTCGG + Exonic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1076864436 10:133160122-133160144 CGGCTCCGCCCCTCGACCCTTGG + Intergenic
1076898573 10:133325920-133325942 CGCCGCCGCCGCCCCAGCCTGGG + Exonic
1077514245 11:2992158-2992180 CCGCGCCCGCGCCGGACCCGCGG + Intronic
1080012322 11:27471997-27472019 CCCCGCCGCCGCCCGGGCCTGGG - Intronic
1081545191 11:44066608-44066630 CCCCGCCGCCCCCCTACCCCAGG + Exonic
1082003713 11:47408556-47408578 CCGCCCGGCCGCCCGGCCCCCGG - Intronic
1083171090 11:60924492-60924514 CGCCGCCGCCGCCCGCCCCGCGG - Exonic
1083904887 11:65662974-65662996 CCCCGCCGCCGCCCGGCGCAGGG + Exonic
1083936601 11:65872839-65872861 CGGCGCCTCCGCCCGCCCTTCGG + Exonic
1083997230 11:66278431-66278453 CCGGGCCGCCGCCCGGCGCGGGG + Exonic
1084978109 11:72814338-72814360 CCCCGCCGCCGCCCGCCCCCTGG + Exonic
1088495801 11:110430240-110430262 CCGCGCTCCCGCCCGGCCCCCGG - Exonic
1088764378 11:112962000-112962022 CCGCCCCGCCGCCCGCCTTTGGG - Intronic
1089273354 11:117316125-117316147 CCGCGCCGCCGCCCGCCGGGGGG - Exonic
1090042288 11:123301770-123301792 CCGTGCTGCCGCCTGCCCCTGGG - Intergenic
1100539947 12:95548565-95548587 CGTCGCCGCCGCGCGCCCCTCGG + Intronic
1102644635 12:114396183-114396205 CCCCGCGGCTGCCCGACCCCGGG + Intronic
1103913383 12:124363847-124363869 CCGGGCAGCCCCCCCACCCTGGG - Intronic
1106568511 13:30906694-30906716 CCGCGCCGCCGCCGGCTCCCCGG - Exonic
1111473570 13:88718118-88718140 CCGCGGTGTGGCCCGACCCTAGG + Intergenic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1114836171 14:26205105-26205127 GCCCGCCGCAGCCCGACTCTGGG + Intergenic
1115320708 14:32076993-32077015 CCGCGCCGCCGCTCCGCCCCCGG + Intronic
1115761676 14:36582674-36582696 CCGCCCCGCACCCCGCCCCTTGG + Intergenic
1118797021 14:69153002-69153024 TCGCGCCGCCGCCCCTCCCTCGG + Exonic
1119793707 14:77376978-77377000 CGACGCCGCCAGCCGACCCTGGG + Exonic
1122065970 14:99174796-99174818 CCGCGCCGCTGCCCAGCCCCGGG - Exonic
1122066037 14:99175086-99175108 CCGCGCCGCCCCCCGCGCCCGGG + Exonic
1122657678 14:103273343-103273365 CCGCGCCCCCGCCCGATCCGCGG + Intergenic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1125536272 15:40442259-40442281 CGGCCCCGTCGCCCGCCCCTCGG - Intronic
1131888654 15:96948029-96948051 CCGCGCTGCTGCCCGGCTCTCGG + Intergenic
1132480581 16:164723-164745 CCGCGGCCCCGCCCGCCCCGCGG - Intronic
1132560199 16:590055-590077 CCGCCGCGCCGCCCCACCCCCGG - Intronic
1132803865 16:1766819-1766841 CCCCCGCGCCGCCCGGCCCTCGG - Intronic
1132942410 16:2514582-2514604 CCGCGCCGCCGCCCGCGCACTGG - Intronic
1133271857 16:4614367-4614389 CCGCGGGGCCGCCCGGCCCTCGG + Intronic
1133325036 16:4937094-4937116 CTGCGCTCCCGCCCGCCCCTCGG - Exonic
1136111003 16:28063586-28063608 CCGCGCCGCGCCCCCACCCCGGG - Intergenic
1137614497 16:49838694-49838716 CCCCCCGGCCGCCCGCCCCTCGG - Intronic
1137787637 16:51151587-51151609 GCGCCGCGCCGCCCGACACTGGG + Intergenic
1139528095 16:67528776-67528798 CCGCCCCGCCGCCCCTCCCCTGG - Intronic
1139779641 16:69339930-69339952 CCGCGCCCCCACTCCACCCTTGG - Intronic
1139896082 16:70289133-70289155 CCGTGCCCCCACCCGCCCCTAGG + Intronic
1139954403 16:70686277-70686299 CAGCGCCGCCCCCCGACCCTCGG - Intergenic
1141972244 16:87492247-87492269 CCGCGCCGCGCCGCGACCCGGGG + Intergenic
1142638307 17:1271049-1271071 CCCAGACGCCGCCCGCCCCTCGG + Exonic
1144127638 17:12217788-12217810 CCGCTCCCCCCCCCCACCCTTGG - Intergenic
1146057574 17:29589074-29589096 CGGCGCCGCCTCCCGCTCCTCGG - Intronic
1147150331 17:38510451-38510473 GCGCGCCGCCGCCTGGCCCGGGG + Exonic
1148051516 17:44772167-44772189 CCTCGCCTCCACCCCACCCTGGG - Intronic
1148759370 17:49991529-49991551 CCGGGCCCCCGCCCAACCCTGGG - Exonic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150643438 17:66964534-66964556 CGGCGCCGCCCCTCGAGCCTCGG - Intergenic
1150643514 17:66964790-66964812 CGGCGCCGCCCCCCGGCCCTCGG + Intergenic
1150830264 17:68512527-68512549 GCCCGCCGCCGCCCGTCCCCAGG + Exonic
1151555218 17:74843183-74843205 CCGGGCCGCCCCCCGACGCCGGG - Exonic
1151719560 17:75847536-75847558 CCCCACCACCGCCCTACCCTGGG - Exonic
1152445423 17:80339999-80340021 CTGCGCCGCTGCCTGACCCTGGG + Exonic
1152603408 17:81276881-81276903 CCGCGCAGCCTCCAGACACTGGG + Intronic
1153688239 18:7567369-7567391 GCGCGCCGCCGCCCGGGGCTGGG + Exonic
1153794472 18:8609676-8609698 GCCCGCCGCCGCCCGCCCCCCGG - Exonic
1156149064 18:34222687-34222709 AGACGCCGCCGCCCGACCCGGGG + Intronic
1156171836 18:34494356-34494378 CCCCGCCGCCCCCCGTCCCCGGG - Intronic
1157849086 18:51030602-51030624 CCTCGCCACCGCCCGAGCCCAGG + Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160930766 19:1568481-1568503 CCCCGCCTCCGCCCGGCGCTCGG + Intergenic
1160988077 19:1848665-1848687 CAGCGCCGCCGCCCGACCTTCGG + Intergenic
1161048850 19:2151455-2151477 CCCCGCCGCCGCCCTGGCCTGGG - Exonic
1161065875 19:2237001-2237023 CGACGCCGCCGCCCCACCCTCGG - Intronic
1161400795 19:4065700-4065722 CCGGGCCGCCGCCCTCCCCGGGG + Intronic
1162021386 19:7869993-7870015 CCACGCCGCCCCCCGACCCCGGG - Exonic
1163148639 19:15398681-15398703 CCTCGCCGGCGCCCGGCCCCTGG - Intronic
1163466471 19:17470847-17470869 CCCCGCCCCCGCCCAGCCCTCGG - Intronic
1165129425 19:33622600-33622622 CCGCTCCGCCTCCTGGCCCTCGG + Intronic
1165345680 19:35247982-35248004 CCGCGCCGCGCCCCCGCCCTCGG + Intergenic
1166827078 19:45616415-45616437 CCGCGCCGCCACCCCGCCCAGGG - Intronic
1166852852 19:45768698-45768720 CGCCGCCGCCGCCTCACCCTCGG + Exonic
1167960774 19:53102963-53102985 CCGCGCCTCCGCCTGGTCCTGGG - Intronic
926980234 2:18560472-18560494 CTGCGCAGCCGCTGGACCCTGGG + Exonic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
927881505 2:26692845-26692867 CCGGGCCGCCGCCGGCCCCCCGG - Exonic
931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG + Intronic
932568029 2:72921468-72921490 CCGCCCCGCCCCCCGACCTGTGG - Intronic
935046638 2:99489526-99489548 CCGCGCCGCCGCCAGCCCCATGG - Intronic
935645368 2:105329783-105329805 CCGCGCCGCCCGCCGGCCCGCGG + Exonic
937083981 2:119158590-119158612 CCTGGCCGGCGCCGGACCCTCGG - Exonic
939003956 2:136765278-136765300 CCGCGCACCCGCACGACCCTCGG - Intergenic
940987278 2:160062323-160062345 AAGCGCCGCCGCCACACCCTCGG + Exonic
942453311 2:176121983-176122005 CCGCGCCCCGGCTCGCCCCTCGG + Intergenic
942463935 2:176188885-176188907 CCGCTCCGACGCCCGGCCCGTGG + Exonic
944154116 2:196593164-196593186 CCGCGCCGCCACCCACCCCCGGG + Intronic
945245253 2:207711709-207711731 CCGCCCCGCGGCCCGGCCCCGGG - Intronic
946242978 2:218367995-218368017 CCGCGTCCCAGCCCGACCCCTGG - Exonic
948046964 2:234952211-234952233 CCGCGCCCCCGCCGGCCCCCAGG - Intronic
948603695 2:239121626-239121648 CCCCGCTGCCGCACGCCCCTCGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169093179 20:2873650-2873672 CAGGGCCGCCGCCCGGCCCGCGG - Intronic
1171217325 20:23362042-23362064 CCGCTCCGCCGCCCGACGTGTGG + Intergenic
1172118369 20:32584336-32584358 CCGCGCCGCTGCCCGGGCCGTGG - Intronic
1172446754 20:34997246-34997268 CAGCTCCTCCGCCCGAGCCTGGG - Exonic
1175846953 20:62064626-62064648 CCGTCCCGCCGCCCGCCCCCGGG - Exonic
1176068978 20:63216271-63216293 CCGCCCCGCCGCACGAGACTGGG - Intergenic
1176085056 20:63292144-63292166 CCTCGAGGCCTCCCGACCCTGGG - Intergenic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1176214477 20:63941718-63941740 CCGCCCCGCTGCCCAAGCCTGGG + Intronic
1176547601 21:8208419-8208441 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176566552 21:8391466-8391488 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176574428 21:8435653-8435675 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176611040 21:8986945-8986967 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1179912179 21:44456178-44456200 CCACTCCGCCGCCCGGCCTTTGG + Intronic
1180649981 22:17369592-17369614 CCGCGCCGCCGCCCCCCGCCCGG + Exonic
1180949394 22:19714410-19714432 CCGCGCCCACGCGCGACCCAGGG - Intergenic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1182123573 22:27801286-27801308 CCGCGCCTTTCCCCGACCCTCGG - Exonic
1184409804 22:44319905-44319927 CCACCCCGCCGCCCATCCCTGGG - Intergenic
1185119447 22:48957379-48957401 TTGCCCCGCCGCCAGACCCTTGG + Intergenic
1185321291 22:50201251-50201273 CCGCGCCGCGGCCCGTGCCCGGG + Exonic
1203252474 22_KI270733v1_random:124704-124726 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203260531 22_KI270733v1_random:169790-169812 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
952908913 3:38165727-38165749 CCCCGGCGCCGTCCGACCCGTGG + Exonic
952942317 3:38454134-38454156 CGGCCCCGCCGACCGGCCCTTGG + Exonic
953167365 3:40477262-40477284 CCGCGCCGCCGCCAGAGCCTGGG + Exonic
956270197 3:67443340-67443362 CCGCGCCGGCGAGCGCCCCTCGG + Intronic
957551452 3:81710972-81710994 CCGCCCCTCCGTCCCACCCTGGG - Intronic
959530739 3:107431552-107431574 CCGCGCTTCCGCCCGAGCCCCGG - Intergenic
961551641 3:127673142-127673164 CCGCCCAGCCGCCCGTCCCAGGG - Intronic
962134694 3:132721924-132721946 CCGCGACGCCGGGAGACCCTTGG - Intronic
962807745 3:138939039-138939061 CGGCCCCGCCGCCCCTCCCTCGG + Intergenic
964474864 3:157089153-157089175 CCTCGCCGCCGCCTGACCGCTGG - Intergenic
965882039 3:173397758-173397780 CCGCGCCGCCGCCTGATCCTCGG - Intronic
968213341 3:196867798-196867820 CCGCCCCGCCTCCCGACCCGGGG - Intergenic
968433839 4:575229-575251 GCGCGCAGCCGCCCGCCTCTCGG - Intergenic
968512734 4:1002669-1002691 CCCAGCCGCCCCCCGACCCAGGG - Intronic
968675011 4:1872163-1872185 CCGGGCCGCGGTCCGGCCCTTGG + Intronic
968803173 4:2756256-2756278 CCTCCCAGCCGCCCGACCCCGGG + Exonic
969370225 4:6727275-6727297 CCGCGCAGCCGCCTGCTCCTTGG + Intergenic
969912142 4:10457011-10457033 CCGGGCCGGACCCCGACCCTAGG + Intronic
970441466 4:16083832-16083854 CGGCGCTGCGGCCGGACCCTCGG + Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
972675690 4:41257497-41257519 CCGCGCCCGCACCCGAGCCTGGG - Intronic
975622169 4:76306583-76306605 CCGCCCCGCTCCCCGCCCCTGGG - Intronic
978503645 4:109434117-109434139 CCGCGCCCGCTCCCGTCCCTCGG - Intronic
979122929 4:116926285-116926307 CCGCGCCGCCGCCCCTCTCCGGG + Intergenic
983919811 4:173333827-173333849 CCGCGCCCCCGCCCGCGCCCCGG + Intronic
984639353 4:182144801-182144823 CGGCGCCGCGGCCCGGCACTAGG - Intronic
985478306 5:92055-92077 CCCCGCCCCGGCCGGACCCTCGG + Intergenic
994083224 5:95731215-95731237 CCCCGCATCCGCCCGACCCCCGG + Exonic
994083351 5:95731650-95731672 CCGAGTCGCCGCCCTGCCCTTGG + Exonic
997319053 5:132963214-132963236 CCGCGGCCCGGCCCGGCCCTGGG + Intronic
997485268 5:134225902-134225924 CCGCGCCGCCGCCCGCACACGGG + Exonic
997990676 5:138542668-138542690 CCGCGCCGACCCTCGCCCCTGGG + Intronic
998152302 5:139764455-139764477 CCACGGCGCCGCCAGACCCCCGG - Intergenic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001070251 5:168579413-168579435 AGGCGCCGCCGCCCCGCCCTAGG - Exonic
1001220521 5:169896170-169896192 CCTCCCCGCCCCCCGACCCCAGG - Intronic
1001639438 5:173234634-173234656 CCCCGCCGCAGCCCAGCCCTCGG + Intronic
1006932761 6:37697608-37697630 CCGCGCCGCAGCCCCGGCCTGGG - Exonic
1014272538 6:119349849-119349871 CCCCGCCCCCGCGGGACCCTGGG - Intergenic
1016330537 6:142947576-142947598 CCGCGCCGCCGCCCTGCCCGGGG + Intergenic
1018331060 6:162727777-162727799 CCGCCCCCGCGCCCGGCCCTAGG + Intronic
1019383829 7:742107-742129 CCACGCCGCCGGCCCACCTTGGG + Intronic
1019404572 7:876889-876911 CCGCGCCGCTGCCCGTCGCGGGG + Intronic
1019461399 7:1160719-1160741 CCGCGCTGCCCCCCGCCCCCTGG + Intronic
1019589965 7:1825961-1825983 CCGCGCCGACCTCCAACCCTGGG - Intronic
1020137382 7:5594580-5594602 CCGCGCCGCCCCCGGGCCCAGGG + Intronic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1023937261 7:44748854-44748876 TCGCGCCGCCGCCCGCTCCGAGG - Intronic
1023937275 7:44748895-44748917 CCGCGCCGCCCGCCGCCCCGGGG - Intronic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1026822307 7:73557720-73557742 GCGCGCACCCGCCCGCCCCTTGG + Exonic
1027260554 7:76461881-76461903 CCGCGCCACCCCGCGCCCCTGGG - Intronic
1027311933 7:76959994-76960016 CCGCGCCCCCCCGCGCCCCTGGG - Intergenic
1029374304 7:100168597-100168619 CCCAGCCACCGCCCGACTCTTGG + Exonic
1030093382 7:105876857-105876879 CAGCGGCGCCGCCCAAGCCTGGG + Intronic
1031447643 7:121873692-121873714 CCGCGCGGCCGCCCGCTCCGTGG - Intronic
1031604314 7:123749366-123749388 CTGCGCCGCCGGCCTTCCCTGGG + Intergenic
1034413110 7:150951416-150951438 TCTCCCCGCCGCCCGCCCCTGGG + Intronic
1035266715 7:157693394-157693416 GCGCGGCGCAGCCAGACCCTAGG - Intronic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036454252 8:8893565-8893587 CCGCGCTCCCGCCCGAGCCCGGG - Exonic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1038035512 8:23683003-23683025 CCGCGGCGCGGCCCGTCCCGCGG - Intergenic
1045304816 8:100950637-100950659 CCGCGCCCCCGCCCAAGCCGTGG + Intronic
1045488625 8:102654216-102654238 CCCCGCCCGCGCCCGACCCGGGG + Intronic
1046770356 8:118111670-118111692 CCGGGCCGCCGCGCGTCCCGGGG - Exonic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1049802088 8:144522553-144522575 GGGCGCCTCCGCCGGACCCTCGG + Exonic
1053409116 9:37904201-37904223 CCGCCCCGCCTCCCCTCCCTCGG + Intronic
1057314145 9:93958299-93958321 CCTCCCCGTCGCCCGACCCCAGG + Intergenic
1057781797 9:98056584-98056606 CCGCCCCGCCGCCCTTCCCGCGG + Intergenic
1058908180 9:109498120-109498142 CCCCGCCCCCACCCGTCCCTGGG - Intronic
1059061402 9:111038267-111038289 CCGGCCCTCCGCCCGCCCCTCGG + Intronic
1061264499 9:129497351-129497373 CCCCGCCCCCGCCCGGGCCTAGG - Intergenic
1061275924 9:129569265-129569287 CCGCGCCCCCGCCCCCTCCTCGG - Intergenic
1061859457 9:133460456-133460478 CCCCGCCGCCCCCCCGCCCTGGG - Intronic
1062082305 9:134630526-134630548 CCGTGCCCCCGCCAGGCCCTGGG + Intergenic
1062549450 9:137079208-137079230 CCGCCCCTCCGCCCAGCCCTCGG + Intronic
1203768420 EBV:38407-38429 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768470 EBV:38532-38554 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768520 EBV:38657-38679 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768570 EBV:38782-38804 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768620 EBV:38907-38929 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768670 EBV:39032-39054 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768720 EBV:39157-39179 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768770 EBV:39282-39304 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768820 EBV:39407-39429 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768870 EBV:39532-39554 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768920 EBV:39657-39679 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203768970 EBV:39782-39804 CTGCGCCGCCGCCAGGTCCTGGG + Intergenic
1203468879 Un_GL000220v1:107855-107877 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203476700 Un_GL000220v1:151827-151849 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1186768059 X:12791459-12791481 CTCCGCCGCCGCGCGCCCCTCGG + Exonic
1186788610 X:12975531-12975553 CCGCGCAGCCGTCCGAGGCTGGG - Exonic
1187518158 X:19990960-19990982 CGCCGCCGCCGCCGGCCCCTCGG + Intergenic
1192817980 X:74614284-74614306 CAGCGCCGCCTCCGGACCCCAGG - Intronic
1199445099 X:147912031-147912053 CCGCGCTGCCGCACGCCCCCTGG - Exonic
1199772729 X:150984352-150984374 CGCCGCCGCCGCCCGCCCGTCGG - Intronic
1200093586 X:153647149-153647171 CCCCGCCCCGGCCCGCCCCTCGG + Intronic