ID: 931356286

View in Genome Browser
Species Human (GRCh38)
Location 2:61539533-61539555
Sequence AAGGGCCTAGTAAATTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931356286_931356288 -8 Left 931356286 2:61539533-61539555 CCACCAAAATTTACTAGGCCCTT 0: 1
1: 1
2: 3
3: 14
4: 191
Right 931356288 2:61539548-61539570 AGGCCCTTTGTGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931356286 Original CRISPR AAGGGCCTAGTAAATTTTGG TGG (reversed) Intergenic
906970220 1:50505408-50505430 AATGGTCTAGAGAATTTTGGGGG + Intronic
907304744 1:53507210-53507232 AAGTGCCCAGTAAATGCTGGTGG - Intronic
907896317 1:58695891-58695913 AAAGGCTGAGTAAGTTTTGGGGG + Intronic
909004663 1:70261108-70261130 ATGGACCTATTGAATTTTGGGGG - Exonic
909515942 1:76507443-76507465 AAGGGCCCAGCAAGTGTTGGGGG - Intronic
909649386 1:77956801-77956823 AATGTTCTAGTTAATTTTGGGGG - Intronic
910481375 1:87662060-87662082 AAGGGGCTAGTACATTTAGAAGG + Intergenic
912879560 1:113396170-113396192 AAGTGCTTTGTAATTTTTGGGGG + Intronic
913617252 1:120573468-120573490 AAGGGCCTAGAATTTTTTGGTGG + Intergenic
914573022 1:148937446-148937468 AAGGGCCTAGAATTTTTTGGTGG - Intronic
914788226 1:150852761-150852783 AAGGGAACAGTAAATTTTTGAGG - Exonic
916191938 1:162187960-162187982 GAGGGCCAAGTAAAATGTGGTGG + Intronic
916292619 1:163183240-163183262 AAGTGGCTGTTAAATTTTGGGGG - Intronic
917922621 1:179763657-179763679 AAGGGCATAGGAGACTTTGGAGG + Intronic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
918755721 1:188337839-188337861 AAGGGCCTCTAGAATTTTGGAGG - Intergenic
921733639 1:218601400-218601422 AGGGGCCAAGAAAATTGTGGAGG + Intergenic
923290828 1:232543936-232543958 AAGCCATTAGTAAATTTTGGAGG + Intronic
924491871 1:244545815-244545837 AAGTGACAAGTAAATTTTAGGGG + Intronic
924645781 1:245876246-245876268 AAGGGCCTAGTAAGGTAAGGTGG + Intronic
1063502005 10:6563735-6563757 AAGTGCTCAGTAAATTTTGGTGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1070580988 10:77719369-77719391 AGGTGCCCAGTAAATGTTGGAGG - Intergenic
1071748860 10:88452305-88452327 AAGTGCCTAGTACACTTTGAAGG + Intronic
1072228435 10:93391660-93391682 AACGGACTAGGAAACTTTGGAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080083623 11:28252253-28252275 AAGGGAATAGGAAATGTTGGTGG + Intronic
1080252576 11:30251039-30251061 CTGGACCTAGAAAATTTTGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085075323 11:73586062-73586084 AGGGGCTTAGTACATTTTTGTGG - Intronic
1085214765 11:74819536-74819558 AAGGGCTCAGTAAATATTTGTGG + Intronic
1086856146 11:91868338-91868360 AACAGCCCAGCAAATTTTGGGGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1095244708 12:39905786-39905808 AAAGGCCTAGTACCTTTTGAAGG - Intronic
1095495188 12:42776789-42776811 AAGTGCATAATAAATCTTGGAGG + Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1099819277 12:87689357-87689379 AAGGGTCTAGTAACATTTGAGGG + Intergenic
1099981071 12:89603546-89603568 GAGTGCTTAGTAAATTTGGGAGG - Intronic
1100507951 12:95239063-95239085 AAGTGGATACTAAATTTTGGGGG + Intronic
1101911875 12:108866157-108866179 CAGGGACTAGTGAATTTTGTGGG - Intronic
1102627316 12:114245369-114245391 AGGGTCCTAGTATATTTTGTGGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108009528 13:45990790-45990812 TAGGTTCTAGTAAATTTTTGGGG + Intronic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1114374514 14:22129785-22129807 GTGGGCCTAGTTAATTTTGAAGG - Intergenic
1114760877 14:25312434-25312456 ATGGGCCTAATAAATTCTTGAGG - Intergenic
1115288341 14:31742526-31742548 AAGTTCTTAGTAAATATTGGTGG - Intronic
1118703932 14:68462400-68462422 AAGAGCCCAGTAAATATTTGTGG + Intronic
1119567455 14:75640828-75640850 GAGGGCCTAGTATGTCTTGGTGG + Intronic
1121380171 14:93458534-93458556 AAGAACCTATAAAATTTTGGGGG + Intronic
1124582646 15:30973863-30973885 AAAGGCCTAGTAATTATTAGTGG - Intronic
1125134687 15:36328175-36328197 AATGGCCTAGACTATTTTGGAGG + Intergenic
1126392587 15:48175949-48175971 TAAGGCCTAGTAAATATTTGTGG - Intronic
1126768226 15:52030365-52030387 AAGTGCTCAGTAAATTTTTGTGG + Intronic
1127923182 15:63510667-63510689 TAGGGGCTAGTACTTTTTGGAGG + Intronic
1128444988 15:67751301-67751323 GTGGTCCAAGTAAATTTTGGTGG + Intronic
1130047591 15:80457955-80457977 AAGGCCCCAGTAAATTTTCAAGG + Exonic
1130862770 15:87905864-87905886 ATGGGCATGGGAAATTTTGGGGG - Intronic
1134694296 16:16211787-16211809 AGGTGCCTATTAAATGTTGGTGG + Intronic
1134977538 16:18582842-18582864 AGGTGCCTATTAAATGTTGGTGG - Intergenic
1136711341 16:32239870-32239892 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136756566 16:32689535-32689557 AAGGGCCTGGTGCATTTAGGTGG - Intergenic
1136811544 16:33180838-33180860 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136818020 16:33290918-33290940 AAGGGCCTGGTGCATTTAGGTGG + Intronic
1136824584 16:33347447-33347469 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136829650 16:33446218-33446240 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1137756119 16:50903726-50903748 ATGGATCTAGTAGATTTTGGTGG - Intergenic
1142339408 16:89510986-89511008 AAGCGCCTAGCTAATTTTTGGGG + Intronic
1202990122 16_KI270728v1_random:3807-3829 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1203058715 16_KI270728v1_random:949889-949911 AAGGGCCTGGTGCATTTAGGTGG - Intergenic
1145040715 17:19576267-19576289 AAGGGCCTACTAAGTATTGAAGG - Intronic
1146036173 17:29408636-29408658 AGGGGCCTAGGAAATTTTGGGGG - Intronic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1148252415 17:46095738-46095760 AAAGGCCAACTACATTTTGGTGG + Intronic
1149499910 17:57144630-57144652 AAGGGTCTCCTACATTTTGGAGG + Intergenic
1150142852 17:62744600-62744622 AAGGGCCCAGCAATGTTTGGGGG + Intronic
1157343707 18:46804121-46804143 AGGTGCCCAGTAAATATTGGTGG - Intergenic
1158534725 18:58297230-58297252 CAGGACCTAATAAATTTTGTGGG + Intronic
1162272824 19:9630212-9630234 AAGGGCTTAGGAAATTCTGGGGG + Intronic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1168042410 19:53769056-53769078 AAGGGGCTAGTATATATTGAAGG + Intergenic
927052514 2:19344713-19344735 AAGAGCCTAATGAATTTTGTGGG + Intergenic
928963778 2:36956815-36956837 ATGGCCCTACTAATTTTTGGGGG - Intronic
929214609 2:39398653-39398675 CATGGCTTAGTAAATTTTTGGGG - Intronic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
935238429 2:101157334-101157356 AAGGGCCTAGTATCTTTTCTTGG - Intronic
938169830 2:129065323-129065345 AAGAACTTAGTAAATATTGGTGG + Intergenic
939789143 2:146549825-146549847 AAAGGATTAGTAAATTTTAGAGG - Intergenic
940149728 2:150586106-150586128 AAGGGCCTAATAAATGTTACTGG - Intergenic
940439487 2:153697444-153697466 CAGGGCCTTTGAAATTTTGGGGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941376808 2:164741325-164741347 AAAAGCCTACTTAATTTTGGAGG + Intronic
942841489 2:180367057-180367079 AAGGTAGTAGTAATTTTTGGGGG - Intergenic
943661538 2:190564491-190564513 GAGGGCATAGCAAATTTTTGTGG - Intergenic
944329912 2:198453579-198453601 AACTTACTAGTAAATTTTGGAGG - Intronic
945851571 2:215014494-215014516 AAGGCCCTTGTAAAATTTGGGGG + Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947923813 2:233903438-233903460 CAGTGCCCAGTAAATATTGGTGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1174047136 20:47741451-47741473 AAGGGAGTAGAAAATATTGGGGG - Intronic
1174735671 20:52963557-52963579 GAGTGCCTAGTAACTCTTGGAGG + Intergenic
1177296782 21:19186317-19186339 ATGGACCAAATAAATTTTGGAGG - Intergenic
1178122239 21:29481003-29481025 AAAGTCCCAGTAGATTTTGGCGG + Intronic
949405223 3:3706792-3706814 AAGGACCTAATAAATGCTGGGGG + Intronic
949781031 3:7688609-7688631 ATGGGACTAGTAAACTTGGGAGG + Intronic
951366926 3:21794615-21794637 AAGGGGCTAGCTAACTTTGGGGG + Intronic
952176015 3:30864139-30864161 TAGGGCCTAAAAAATTTGGGAGG - Intronic
953297217 3:41731654-41731676 AAGAGCCAAATCAATTTTGGGGG + Intronic
954298884 3:49688832-49688854 AAGGGCCTAGTACAGCTTAGTGG + Exonic
954357851 3:50097622-50097644 AAGAGACTAGTATATTTTTGTGG + Intronic
955798385 3:62661445-62661467 AAGGGCCTGGTATATTTGGAGGG + Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957393712 3:79613145-79613167 AAGGGTCAAGTATATTTTGGAGG + Intronic
959995808 3:112679181-112679203 AGGGCCCAAGGAAATTTTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961342984 3:126242147-126242169 AATGGACTAATAAATATTGGAGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
969711173 4:8845022-8845044 AAGCCCCCAGTAAATGTTGGTGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970122466 4:12771901-12771923 AGGGGCCTAGTAATTGCTGGGGG + Intergenic
970848316 4:20570599-20570621 AAGAACCCAGTTAATTTTGGAGG + Intronic
971773999 4:30936760-30936782 AAGAGACTAATAGATTTTGGTGG + Intronic
972884878 4:43472823-43472845 AGGGTCCAAGTAAATTTTTGGGG - Intergenic
974679576 4:65144010-65144032 AAGGTCATGGCAAATTTTGGGGG - Intergenic
978634452 4:110787229-110787251 AAGGGCACAGTAAATTTTGGTGG + Intergenic
979218194 4:118191573-118191595 AAGGGCCTACTTAATTTTTGTGG + Intronic
980014958 4:127638877-127638899 AAGGTCTTAGAAAATTTTGAAGG + Intronic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
981886053 4:149674318-149674340 AAGGGCTTACTATATTTTGTTGG - Intergenic
982925388 4:161331092-161331114 AAGGGACTAGAAAACTATGGAGG - Intergenic
985063852 4:186103479-186103501 AAGTGCCCAGTACATGTTGGTGG + Intergenic
986064478 5:4222392-4222414 AAGAGGCTAATAAATTCTGGGGG - Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
986868656 5:12020180-12020202 AAGTGCTCAGTAAATTTTGCCGG - Intergenic
987191500 5:15483238-15483260 AATGACCTAGTATAATTTGGAGG + Intergenic
987272141 5:16321818-16321840 AAGGGACTAGCAAATTATGCTGG + Intergenic
988633406 5:32955599-32955621 GAGGGAGTAGGAAATTTTGGGGG + Intergenic
991124335 5:63052587-63052609 AAAAGCCTAGTGAATTGTGGGGG + Intergenic
992451577 5:76880892-76880914 CAGGGCCTCGGGAATTTTGGAGG + Intronic
993346267 5:86787169-86787191 AAAGGCTTAGGAAATGTTGGGGG - Intergenic
993688209 5:90966680-90966702 GAGGAACTAGTAAATGTTGGGGG + Intronic
993996328 5:94727934-94727956 AAGGGCCTGGCAAATTTGAGGGG + Intronic
994980452 5:106868430-106868452 AAGGGCCTAGTGAATAGTGGAGG + Intergenic
995095234 5:108228243-108228265 AAGGGCCTTGAAGATTTGGGTGG + Intronic
996139532 5:119889011-119889033 AAGGGCTTAGTAAATTTTGGTGG - Intergenic
999408392 5:151327166-151327188 AAGGGCTTAGTAAATGTTGGCGG + Intronic
1005749605 6:28870656-28870678 CAGGGCCTAGCAGATATTGGCGG + Intergenic
1006863774 6:37191931-37191953 AAGGGCCCGGGAACTTTTGGGGG - Intergenic
1007486552 6:42184622-42184644 CAGGGCATAGTCCATTTTGGAGG - Exonic
1009195986 6:60685008-60685030 AAGAACCATGTAAATTTTGGTGG - Intergenic
1009344577 6:62597352-62597374 AAGTGCCTAGTAAATTCTATGGG - Intergenic
1010401905 6:75455534-75455556 AAGTGCTTTGTAAATTGTGGGGG + Intronic
1010763834 6:79755822-79755844 AATAGAGTAGTAAATTTTGGGGG + Intergenic
1013036406 6:106388278-106388300 CAGGACCTAGAAAATTTGGGAGG - Intergenic
1013093191 6:106919957-106919979 AAGGGGAGAGTAGATTTTGGTGG + Intergenic
1014456662 6:121643219-121643241 AACAGCCTAATAACTTTTGGTGG - Intergenic
1016221994 6:141685486-141685508 ATGGGCAGAATAAATTTTGGGGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1024990805 7:55233465-55233487 AAGGGTCTGGAAAATCTTGGCGG + Intronic
1027431900 7:78122946-78122968 AATGGCCTAATAAAATTGGGAGG - Intronic
1027776235 7:82468253-82468275 AAGGGCCTATAACATTTTGCTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030155015 7:106445928-106445950 AAGGCCCAAGGAAATTTTAGGGG - Intergenic
1030669864 7:112324571-112324593 AAGGGCCAAGAAAATCTTTGGGG - Intronic
1030860671 7:114622016-114622038 AAGGGTATAGTAAATGCTGGGGG + Intronic
1031372465 7:120984817-120984839 AAGGGCATGGTGAATTTTGTGGG - Intergenic
1033859746 7:145609777-145609799 AAGGGCCTTGTCAATTTTGAGGG - Intergenic
1034298491 7:149994731-149994753 AAGTGCCTAGAAAATCTTGGAGG + Intergenic
1034807526 7:154102051-154102073 AAGTGCCTAGAAAATCTTAGAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039194493 8:35015636-35015658 AAGGGCCTAGTAAATTAGATAGG - Intergenic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1042170964 8:65990381-65990403 AAGTGCTTAGTAAGTGTTGGTGG + Intergenic
1048446398 8:134496615-134496637 CAGGGCCTGGTACATTTTAGAGG - Intronic
1049289523 8:141794411-141794433 CTGGCCCTAGTAAATGTTGGAGG + Intergenic
1051405202 9:16729774-16729796 AAGAGGCTAGCAAATTTTAGAGG - Intronic
1056420227 9:86417836-86417858 AATGGTTCAGTAAATTTTGGAGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058637922 9:107054931-107054953 AAGTGCTCAGTAAATGTTGGTGG - Intergenic
1059998210 9:119934252-119934274 AAGGACCTAGTAAATGTCGTTGG + Intergenic
1060260945 9:122072957-122072979 AAGGGCTTAGAAAATGTTTGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1186385777 X:9109080-9109102 AAGGGACAGGAAAATTTTGGAGG - Intronic
1190964064 X:55280710-55280732 ATGGGCCTAGTAAATTAAAGTGG + Intronic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1196303861 X:114077592-114077614 AAGGCCTTAGTAAATTCGGGAGG + Intergenic
1198999820 X:142621936-142621958 AATCGTCTAGTAAATCTTGGTGG - Intergenic