ID: 931357622

View in Genome Browser
Species Human (GRCh38)
Location 2:61550871-61550893
Sequence GGACCACTAAAGGACCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931357611_931357622 26 Left 931357611 2:61550822-61550844 CCAGGTGAGGGTGGGGGTTAGGG No data
Right 931357622 2:61550871-61550893 GGACCACTAAAGGACCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931357622 Original CRISPR GGACCACTAAAGGACCCTAA AGG Intergenic
No off target data available for this crispr