ID: 931371866

View in Genome Browser
Species Human (GRCh38)
Location 2:61670573-61670595
Sequence GCACATTTAGTATCTAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931371865_931371866 -3 Left 931371865 2:61670553-61670575 CCAGTGGTGCTTTTGTGAAAGCA No data
Right 931371866 2:61670573-61670595 GCACATTTAGTATCTAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931371866 Original CRISPR GCACATTTAGTATCTAAGAA TGG Intergenic
No off target data available for this crispr