ID: 931372764

View in Genome Browser
Species Human (GRCh38)
Location 2:61679176-61679198
Sequence GTCTGAGGCTAGGAATTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931372764_931372768 0 Left 931372764 2:61679176-61679198 CCTTAAAATTCCTAGCCTCAGAC No data
Right 931372768 2:61679199-61679221 TCCTCAGGAAGATAGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931372764 Original CRISPR GTCTGAGGCTAGGAATTTTA AGG (reversed) Intergenic
No off target data available for this crispr