ID: 931376578

View in Genome Browser
Species Human (GRCh38)
Location 2:61713495-61713517
Sequence TCGAAAAGGCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931376571_931376578 4 Left 931376571 2:61713468-61713490 CCTAGGGAGCAGTAAAAAGATCG No data
Right 931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931376578 Original CRISPR TCGAAAAGGCAGGAGGAGGA AGG Intergenic
No off target data available for this crispr